ID: 924116719

View in Genome Browser
Species Human (GRCh38)
Location 1:240754279-240754301
Sequence GAGACTGAGCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924116719_924116728 26 Left 924116719 1:240754279-240754301 CCCTCTTCCCTCTGCTCAGTCTC No data
Right 924116728 1:240754328-240754350 AATGTCCTCCTCAGTCTGCTTGG No data
924116719_924116725 2 Left 924116719 1:240754279-240754301 CCCTCTTCCCTCTGCTCAGTCTC No data
Right 924116725 1:240754304-240754326 GAAACCTGTACCTCAGGCTCTGG No data
924116719_924116723 -4 Left 924116719 1:240754279-240754301 CCCTCTTCCCTCTGCTCAGTCTC No data
Right 924116723 1:240754298-240754320 TCTCCAGAAACCTGTACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924116719 Original CRISPR GAGACTGAGCAGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr