ID: 924117032

View in Genome Browser
Species Human (GRCh38)
Location 1:240757971-240757993
Sequence CCGTCTCTACTAAAGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924117032_924117037 2 Left 924117032 1:240757971-240757993 CCTTGTACCTTTAGTAGAGACGG No data
Right 924117037 1:240757996-240758018 CTTCACCATGCCGGCCAGGATGG No data
924117032_924117036 -2 Left 924117032 1:240757971-240757993 CCTTGTACCTTTAGTAGAGACGG No data
Right 924117036 1:240757992-240758014 GGCGCTTCACCATGCCGGCCAGG No data
924117032_924117035 -7 Left 924117032 1:240757971-240757993 CCTTGTACCTTTAGTAGAGACGG No data
Right 924117035 1:240757987-240758009 GAGACGGCGCTTCACCATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924117032 Original CRISPR CCGTCTCTACTAAAGGTACA AGG (reversed) Intergenic
No off target data available for this crispr