ID: 924117906

View in Genome Browser
Species Human (GRCh38)
Location 1:240765943-240765965
Sequence AAAGCCGCAGCCTGTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924117905_924117906 -3 Left 924117905 1:240765923-240765945 CCTGTTGTTCTCTTTCATGGAAA No data
Right 924117906 1:240765943-240765965 AAAGCCGCAGCCTGTTTCCCAGG No data
924117903_924117906 0 Left 924117903 1:240765920-240765942 CCTCCTGTTGTTCTCTTTCATGG No data
Right 924117906 1:240765943-240765965 AAAGCCGCAGCCTGTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924117906 Original CRISPR AAAGCCGCAGCCTGTTTCCC AGG Intergenic
No off target data available for this crispr