ID: 924118476

View in Genome Browser
Species Human (GRCh38)
Location 1:240771619-240771641
Sequence GCTGACGGGAAGCCTCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924118462_924118476 25 Left 924118462 1:240771571-240771593 CCAGCCAGCGCGCAGGGCAGGGG No data
Right 924118476 1:240771619-240771641 GCTGACGGGAAGCCTCGAGGAGG No data
924118459_924118476 30 Left 924118459 1:240771566-240771588 CCAGGCCAGCCAGCGCGCAGGGC No data
Right 924118476 1:240771619-240771641 GCTGACGGGAAGCCTCGAGGAGG No data
924118465_924118476 21 Left 924118465 1:240771575-240771597 CCAGCGCGCAGGGCAGGGGCGGG No data
Right 924118476 1:240771619-240771641 GCTGACGGGAAGCCTCGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924118476 Original CRISPR GCTGACGGGAAGCCTCGAGG AGG Intergenic
No off target data available for this crispr