ID: 924124831

View in Genome Browser
Species Human (GRCh38)
Location 1:240839653-240839675
Sequence GAGGTGAAGGGCAGCATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924124827_924124831 3 Left 924124827 1:240839627-240839649 CCGAGGGGTGGGGAGAAAAGTTA 0: 1
1: 0
2: 0
3: 19
4: 223
Right 924124831 1:240839653-240839675 GAGGTGAAGGGCAGCATTCTTGG 0: 1
1: 0
2: 0
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924124831 Original CRISPR GAGGTGAAGGGCAGCATTCT TGG Intronic
900207398 1:1437463-1437485 GAGCTGAGGGGCTCCATTCTCGG + Exonic
900596957 1:3484292-3484314 GAGGAGATGGGCAGAATTCACGG - Intergenic
903389756 1:22955399-22955421 GAAGTGGAGCGCAGCCTTCTGGG + Exonic
904197456 1:28796445-28796467 GAGGTAAAGGGCATCTTTCTGGG + Intergenic
904321057 1:29698138-29698160 GTGGGGAAGGGCAGTATTTTGGG - Intergenic
904693071 1:32309328-32309350 GAGGTCAAGGACAGCTTTTTGGG + Intronic
904934834 1:34122788-34122810 GAGGTGAAGGGCATCTTACCAGG + Intronic
904942138 1:34171295-34171317 AAGGAGAAGGGAAGCTTTCTAGG - Intronic
905476996 1:38236013-38236035 AAGGAGAAGGGGAGCATTCAGGG - Intergenic
905757424 1:40522979-40523001 GGGGAGATGGGCAGCTTTCTGGG - Intergenic
906739863 1:48172562-48172584 GAAGGAAAGGGCAGCAATCTTGG - Intergenic
908508979 1:64835835-64835857 GAGATGAAGGGCAGTTTTATGGG - Intronic
909037407 1:70609659-70609681 GTGGTGAAGTGCAGCAGTGTAGG - Intergenic
909727911 1:78857978-78858000 GGGATGAGGGGCAGCAGTCTGGG - Intergenic
911165846 1:94723750-94723772 GAGATGGAGGTCAGCATTCTGGG - Intergenic
911830113 1:102539622-102539644 CAGGTGAAGTTCAGCATTGTCGG - Intergenic
912777091 1:112512555-112512577 CAGGTGAAGAGAAGCATTCTGGG + Intronic
913999237 1:143678802-143678824 GAGGTGAAGGGAAGAAATCTTGG - Intergenic
914194267 1:145436951-145436973 CAGGTGAAGAGAAGAATTCTGGG + Intergenic
914313590 1:146488215-146488237 GAGGTGAAGGGAAGACATCTTGG + Intergenic
914475593 1:148019827-148019849 CAGGTGAAGAGAAGAATTCTGGG + Intergenic
914500758 1:148245166-148245188 GAGGTGAAGGGAAGACATCTTGG - Intergenic
914504409 1:148276232-148276254 GAGGTGAAGGGAAGAAATCTGGG - Intergenic
915038560 1:152948737-152948759 GAGGTGGAGGGCAGCACTGCTGG - Intergenic
916488529 1:165280441-165280463 AAGATGAAGGGGAGCATTCAGGG + Intronic
918044722 1:180935070-180935092 GAGGTCAAGGGCAGAAACCTGGG - Intronic
918110646 1:181452510-181452532 GAGGGGATGGGAAGCATTCAGGG + Intronic
918431380 1:184464412-184464434 AAGGTGAAGGAGAGCCTTCTAGG + Intronic
919524989 1:198635862-198635884 GAGGAGAAGGAAAGTATTCTAGG - Intergenic
919851148 1:201673895-201673917 AACGTGAAGGGCAGCAGTCATGG + Intronic
920075060 1:203330144-203330166 CAGGTGAAGGGCAGCATCAAGGG - Intergenic
920500116 1:206480355-206480377 GAGGTGGAGGCCAGTATCCTGGG + Intronic
922210119 1:223479856-223479878 GAGGAGAAGGGCTGCCTGCTTGG - Intergenic
922970418 1:229731659-229731681 GAGATAATGGGTAGCATTCTGGG - Intergenic
923277828 1:232414228-232414250 TAGGTGAAAGGCAGCTTGCTAGG - Intronic
923343249 1:233025275-233025297 GAGGTGAAAGGCAGCGTTGCAGG + Exonic
923478162 1:234356858-234356880 GAGGTGGTGGGCAGCATGGTGGG - Intergenic
923546817 1:234929275-234929297 GAGGTGAAGGAATGCTTTCTGGG - Intergenic
924124831 1:240839653-240839675 GAGGTGAAGGGCAGCATTCTTGG + Intronic
1063560133 10:7118567-7118589 GAGGTGAAGAACAGCAATCAGGG - Intergenic
1064071150 10:12229158-12229180 TAGGGGAAGGGCAGCAACCTGGG - Intronic
1065428341 10:25628786-25628808 GAGGTGGAGGCCATCATCCTCGG - Intergenic
1065461966 10:25977381-25977403 GAGGGGTTGGGCAGCATTCAAGG + Intronic
1067423993 10:46187885-46187907 GAGGTGAATGCCACCATGCTTGG - Intergenic
1071428255 10:85581283-85581305 GAGGTGAATGGCAGAACACTAGG - Intergenic
1072862458 10:99020796-99020818 CAGGTGAAGGGAGACATTCTAGG + Intronic
1074600768 10:114911212-114911234 GGGGTGGAGGGCAGCAATCTGGG + Intergenic
1074679260 10:115887463-115887485 AAGGTGCAGGACAGCTTTCTGGG + Intronic
1075184504 10:120243614-120243636 GAAGTGGAGGGCAGCCTTTTGGG - Intergenic
1075276609 10:121099329-121099351 GAGGTGAGGAGCAGACTTCTTGG + Intergenic
1075636420 10:124034008-124034030 GAGGGGAAGGGCAGGATGCCAGG - Intronic
1078225279 11:9385517-9385539 CAGGTGAAGTGCACCCTTCTAGG + Intronic
1079343860 11:19634748-19634770 GAAGAGAAGGACAGAATTCTGGG + Intronic
1080522052 11:33076125-33076147 GAGGTGAAGGGCAGAAGAGTGGG - Intronic
1080723576 11:34872716-34872738 GAAGTGGAGGGCAGCCTTCTGGG + Intronic
1080898727 11:36467527-36467549 GAGATGAAAGGCAGCTTCCTGGG - Intergenic
1081620383 11:44615758-44615780 GAGGTGTTGGGGAGCCTTCTAGG + Intronic
1082810800 11:57477694-57477716 GAGCTGAAGCCCTGCATTCTAGG + Intergenic
1083936436 11:65872338-65872360 GAGGCGCAGGGGAGCATCCTGGG + Exonic
1084437880 11:69154833-69154855 AAGATGAAGGGGAGCAGTCTGGG + Intergenic
1086045301 11:82525009-82525031 AAGGTGAAGGTCTGCATTGTGGG + Intergenic
1089288078 11:117420348-117420370 GAGGTGGATGGCACCATTCCAGG - Intergenic
1089581687 11:119485345-119485367 GGGCTGCAGGGCAGCAGTCTGGG - Intergenic
1093455260 12:19358873-19358895 GAGGTGATGGACAGCACACTTGG - Intronic
1094487083 12:30933864-30933886 GAGGACATGGGAAGCATTCTAGG - Intronic
1095509646 12:42936622-42936644 GAGGTGAGAAGGAGCATTCTAGG + Intergenic
1097260915 12:57719857-57719879 TAGGTGACGGGCAGAATTATTGG + Intronic
1097400058 12:59117634-59117656 GAGGTGGAATGCATCATTCTGGG + Intergenic
1097901151 12:64875103-64875125 GATGTGGATGACAGCATTCTTGG - Exonic
1099612614 12:84893591-84893613 GAAATGAAGGGCGGAATTCTTGG - Intronic
1100584989 12:95971217-95971239 GAAGAGAAGGAAAGCATTCTGGG - Intergenic
1101987592 12:109459996-109460018 GAGGTGGTGTGCAGCATTATGGG + Intronic
1102169487 12:110831232-110831254 GTAGTGAAGGGCAGGATGCTGGG - Intergenic
1103917371 12:124382920-124382942 GAGGTGAAGCCCAGTATCCTTGG + Intronic
1103943632 12:124514198-124514220 GAGGGGCAGGGCGGCTTTCTGGG - Intronic
1104530005 12:129560800-129560822 GAGGTGTCTGGCAGCATTCCCGG - Intronic
1104636457 12:130440543-130440565 GAGGTGAAGGGCACCTCTCTCGG - Intronic
1106313302 13:28572467-28572489 GAGGTGAAGGGCATTGTTATAGG - Intergenic
1106435482 13:29720036-29720058 GCAGTGAAGGGCAGCAGTGTGGG + Intergenic
1107043157 13:35969896-35969918 AAGGGGAAAGGCAGCCTTCTGGG - Intronic
1107808814 13:44179620-44179642 GAGGTTAAGGGCAGAATCTTTGG + Intergenic
1108303688 13:49108383-49108405 GTGGTGAAGGGAAGCAGCCTTGG + Intronic
1108591658 13:51917881-51917903 GAGGAGAAGGGCGACATTCTTGG - Intergenic
1112607610 13:100922480-100922502 GAGGTGAGGGGCAGAAGTATCGG - Intergenic
1113103013 13:106741113-106741135 GAAGTCAAGGGCTGCATCCTTGG + Intergenic
1114671403 14:24413311-24413333 AAGGTGAAAGGCAGCAAGCTGGG - Exonic
1114972310 14:28048141-28048163 GAGCTGAAGGCCATGATTCTAGG - Intergenic
1115676747 14:35684676-35684698 CAGGTGCAAGGCATCATTCTTGG - Intronic
1116536149 14:46033517-46033539 GAGGTAAGGTGCAGTATTCTTGG + Intergenic
1119848291 14:77847051-77847073 GAGGTGAAGGGAGGCAGGCTTGG + Intronic
1119886564 14:78148472-78148494 GAGGTGAAGTACAGGATGCTGGG + Intergenic
1120771616 14:88385835-88385857 GAGGTAAAGGGCAGCTGTCAGGG + Exonic
1120855207 14:89205981-89206003 GAGGGGACGGGCAGCTCTCTAGG - Intronic
1124666223 15:31595090-31595112 TATTTGGAGGGCAGCATTCTTGG + Intronic
1125234039 15:37490948-37490970 GAGATGATGGGCAGCATGGTGGG + Intergenic
1125297840 15:38222063-38222085 AAGGTGAAGGAGAGGATTCTGGG - Intergenic
1126544805 15:49861750-49861772 AAGGGGAAGAGCAGCATGCTGGG - Intronic
1130374392 15:83315292-83315314 CAGGTGCAGGTCAGCATGCTTGG + Intergenic
1130949155 15:88571792-88571814 GTGCTGCAAGGCAGCATTCTGGG + Intergenic
1131435421 15:92417987-92418009 GAGGTGAAGGGCAGGACGCAGGG + Intronic
1133452035 16:5911788-5911810 GAGGGGAAGGGGAGCTCTCTAGG + Intergenic
1136028070 16:27482632-27482654 GAGGCGAAGGGCAGGAGTCTGGG + Intronic
1136279398 16:29199123-29199145 GAGGTGACAGGCAGCCTTTTGGG - Intergenic
1136574068 16:31112889-31112911 GAGGTGAAGGTCACCAGACTGGG + Intergenic
1138111308 16:54326368-54326390 GAGGAGGAGGGAAGGATTCTTGG - Intergenic
1140428414 16:74880698-74880720 GAGGTGAAATGAATCATTCTTGG + Intronic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1141939586 16:87265957-87265979 GAGGTGATGGGGTGCATTCAGGG - Intronic
1141970369 16:87477840-87477862 GCGGTGAGGGGCAGCAGACTCGG - Intronic
1142083788 16:88165224-88165246 GAGGTGACAGGCAGCCTTTTGGG - Intergenic
1142277658 16:89131182-89131204 GAAGTGCAGGGCTGCAGTCTTGG + Intronic
1142689233 17:1594945-1594967 GAGGTCAAAGGCAGCACTCTGGG - Intronic
1143158092 17:4851592-4851614 GAGATGAAGGGAAGGCTTCTCGG - Intronic
1143223923 17:5283886-5283908 GAAGGGAAGGGAAGCATTTTTGG + Intronic
1143766777 17:9143073-9143095 GGGATGAAGGGCAGCCGTCTGGG + Intronic
1144469446 17:15524441-15524463 GGGGTTAAGGACAGGATTCTTGG + Intronic
1144926909 17:18819235-18819257 GGGGTTAAGGACAGGATTCTTGG - Intergenic
1146534004 17:33633974-33633996 GAGGGCAAGGGCAGGATCCTGGG - Intronic
1147135279 17:38430439-38430461 GGGAAGAAGTGCAGCATTCTTGG + Intronic
1148351250 17:46943510-46943532 GAGGGGAGGGGCAGGCTTCTTGG - Intronic
1153596667 18:6732379-6732401 AAGGTAAAGGGCCACATTCTTGG - Intronic
1155050950 18:22147293-22147315 GAGGAGAAGGGCAGTATTTGAGG + Intergenic
1155342070 18:24822914-24822936 CAGGTGCAGGGCAGGATACTAGG - Intergenic
1157451466 18:47792236-47792258 GATGTGAAGGGCAGGACTCCGGG + Intergenic
1159002768 18:62988289-62988311 GAGGTGAAGGGAAGGGCTCTGGG - Intergenic
1159627623 18:70713212-70713234 GAAGTGAAGAGGAGGATTCTTGG + Intergenic
1160257600 18:77260338-77260360 GAGGTGTAAGGCAGCTCTCTGGG + Intronic
1160718001 19:585089-585111 GGGGTGAGGGGCTGCTTTCTCGG - Intergenic
1161141165 19:2648807-2648829 AAGGTGGAGGGCAGGAGTCTGGG - Intronic
1162722496 19:12670638-12670660 GAGGGGGAGGGCAGCACCCTGGG - Exonic
1163076776 19:14899647-14899669 GAGGAGCAGGGTAGGATTCTTGG - Intergenic
1163127560 19:15252516-15252538 GGGGTGAATGGCTGTATTCTTGG - Intronic
1163350330 19:16772878-16772900 GAAGGAAAGGGAAGCATTCTAGG + Intronic
1167859497 19:52271255-52271277 GAGGTGAGGGGCAGTCTTGTGGG + Intronic
925259001 2:2513194-2513216 GATGTGAAGGGCTTCATTCATGG + Intergenic
925572717 2:5329096-5329118 AAGGTCAGGGGCAGCCTTCTGGG + Intergenic
925976560 2:9146143-9146165 GAGGTGAACGTCAGGAGTCTTGG - Intergenic
930554656 2:52880316-52880338 GAGGTGAAAGGAGGAATTCTGGG + Intergenic
932412325 2:71554759-71554781 GAGGTGAGGAGGAGCCTTCTGGG + Intronic
934791904 2:97068925-97068947 GAGGCCAAGGGCAGCCTTCTTGG + Intergenic
934814715 2:97314785-97314807 GAGGCCAAGGGCAGCCTTCTTGG - Intergenic
934822979 2:97393698-97393720 GAGGCCAAGGGCAGCCTTCTTGG + Intergenic
935148338 2:100411882-100411904 AAGGTGAAGGGCAGGGTTCCAGG + Intronic
935445023 2:103147161-103147183 GAGGAGAGGAACAGCATTCTAGG + Intergenic
936522538 2:113220209-113220231 GAGGTGAAGGGCATCAATGCAGG + Intronic
937981760 2:127619934-127619956 GAGGGGAGGGGCTGCATTCAGGG + Intronic
938156170 2:128942283-128942305 CAGGTGAAGGGCATCAGTGTAGG - Intergenic
938726625 2:134114387-134114409 GAGGGGAATGCCAGCATTTTTGG - Intergenic
939157779 2:138545093-138545115 GAGGTAGGGGACAGCATTCTGGG - Intronic
941025779 2:160454627-160454649 GAAGTGAAGGCCAGCATGCCTGG + Intronic
943388670 2:187233890-187233912 TAGGTGATGGGAAGCAGTCTTGG + Intergenic
944231637 2:197400084-197400106 GAAGTATTGGGCAGCATTCTTGG - Exonic
944476467 2:200111826-200111848 GAAGTGCAGTGCTGCATTCTTGG + Intergenic
944570634 2:201041458-201041480 CAGGAGCAGGACAGCATTCTAGG - Intronic
945150741 2:206788080-206788102 GAGGTGCTGAGCAGCCTTCTGGG + Exonic
946478827 2:220034188-220034210 GAAGTGCAGGGCAGTATTCAGGG + Intergenic
947289788 2:228559960-228559982 GAGGTGACGGGCAGCATTTGTGG + Intergenic
947397046 2:229696623-229696645 GAGTGGAGGGGCAGCATTCATGG + Intronic
947672573 2:231947653-231947675 GAGGTGACGTGGAGGATTCTAGG + Intergenic
948387474 2:237590643-237590665 GAGGTCAAGAGCAGCAGCCTCGG + Exonic
948790666 2:240374998-240375020 GAGGTGAAGGGTAGCTTTGCTGG - Intergenic
1169870904 20:10247213-10247235 GAGCTCAGGGGCAGCCTTCTGGG - Intronic
1170036762 20:11997910-11997932 GAGGTGAAGGTGACCCTTCTTGG - Intergenic
1170922733 20:20694165-20694187 GAGGTTAAGGGAAGCATGCCTGG + Intronic
1171037902 20:21731077-21731099 GATGTGAAGGGCATCTTTCTGGG - Intergenic
1172612743 20:36263954-36263976 GAGGTGTGAGGCAGCATGCTAGG - Intronic
1173581020 20:44146545-44146567 GTGGTGAAGGGCAGGAGTCCGGG + Intronic
1173923694 20:46764903-46764925 GAAATGAAGGGAAGCATTCCAGG + Intergenic
1174186109 20:48707387-48707409 GAGGAGAGGGGCTGCATTCAGGG - Intronic
1174728542 20:52890785-52890807 GTCTTGAAAGGCAGCATTCTTGG + Intergenic
1174867558 20:54152056-54152078 GAGGTGAGGGGCAGCAGACGTGG + Intergenic
1176306870 21:5128247-5128269 GAGGTGAAGGGCTGCGCGCTGGG + Exonic
1178256641 21:31058960-31058982 GAGGTGGGTTGCAGCATTCTGGG - Intergenic
1179850187 21:44133783-44133805 GAGGTGAAGGGCTGCGCGCTGGG - Exonic
1181046517 22:20217141-20217163 GAGGACACGGGCAGAATTCTTGG + Intergenic
1181230232 22:21417558-21417580 GAGGTGAGGGGCGGCCTTGTGGG + Intronic
1181248417 22:21517305-21517327 GAGGTGAGGGGCGGCCTTGTGGG - Intergenic
1181994315 22:26863067-26863089 GAGGAGGAGGGCAGCATTAGGGG + Intergenic
1182231970 22:28845100-28845122 CAGGTGCATGGCACCATTCTCGG - Intergenic
1182320645 22:29476764-29476786 GAGGGGATGGGCAGCTTTCTGGG - Intergenic
1183738596 22:39657541-39657563 GGGGTTAAGGGCAGGAGTCTTGG + Intronic
1184458850 22:44626015-44626037 GAGGAGGAGGGCTGCATCCTGGG - Intergenic
1185188811 22:49419834-49419856 GAGGAGGAGAGCAGCATTGTTGG + Intronic
950465120 3:13149027-13149049 GTGGTGAGGGGCAGCATTGGAGG - Intergenic
950902726 3:16512622-16512644 GAGGTGAAGGGCACCAGCCCTGG + Intronic
953033667 3:39193480-39193502 GAGGGGAAGGGCGGCATGCAGGG + Intergenic
953203761 3:40801605-40801627 AAGGTGAAGGGAAGGATGCTTGG + Intergenic
954405156 3:50341342-50341364 GAGGTTCAGGGGTGCATTCTGGG + Exonic
954704392 3:52471497-52471519 GCGGAGAGGGACAGCATTCTGGG - Intronic
955377791 3:58412509-58412531 GAGGTGCAGAGCAGCCTGCTGGG - Intronic
956640634 3:71412343-71412365 GGGGTGAAGGGCAGGTTTCTAGG + Intronic
957732760 3:84162619-84162641 AAGGGCAAGGGCAGCATTCTGGG - Intergenic
959588286 3:108046979-108047001 GACCTGAAAGGCATCATTCTTGG + Intronic
959939230 3:112062961-112062983 GAGGTAAGGGGCAGGAGTCTGGG + Intronic
959942969 3:112098794-112098816 AAGGGGAAAGGCAGCTTTCTGGG + Intronic
961967043 3:130915967-130915989 TATGTGAAGGGCAGCATTACTGG + Intronic
966160518 3:176962750-176962772 GAGGTGCTGGGCTGCATTGTTGG - Intergenic
966914825 3:184578868-184578890 GAGGTGAGGGAGAGCATTCCTGG + Intronic
968133103 3:196203654-196203676 GATCAGGAGGGCAGCATTCTGGG + Intronic
968661858 4:1801969-1801991 GAGGTGAATGGCAGCAAGGTGGG + Exonic
969544254 4:7814032-7814054 GAGGTGAAGGGCAGGACTTGTGG - Intronic
969967528 4:11012719-11012741 GACATGAACGGCAGCATCCTCGG + Intergenic
970385323 4:15550168-15550190 GAGGTGAAGGGCCCCATTGCAGG - Intronic
971097158 4:23420183-23420205 AGGGGGAAGGGAAGCATTCTGGG + Intergenic
974252020 4:59397412-59397434 GAGATCAAGAGCAGAATTCTCGG - Intergenic
974271238 4:59653711-59653733 ATGGTGAAGGGTAGCATCCTCGG + Intergenic
975248246 4:72145570-72145592 CAGGTGAATGGGAGAATTCTTGG + Intronic
976264656 4:83179137-83179159 TAGGAAAAGGGCAGCATCCTAGG + Intergenic
978319813 4:107481386-107481408 GAGGTGGTGGGCATCATACTGGG + Intergenic
981496933 4:145404279-145404301 GAGGTCAAGGACAGCTTCCTTGG - Intergenic
986683106 5:10251070-10251092 GGGGTGAGAGGTAGCATTCTAGG + Intronic
986840762 5:11694382-11694404 GAGGTGCAGTGCTGCAATCTCGG - Intronic
988042059 5:25902197-25902219 GAAGGGAAAGGCAGCAATCTAGG + Intergenic
988586937 5:32515211-32515233 GAGGTGCTGGCCAGCATTCAGGG + Intergenic
989096887 5:37790112-37790134 GAGGTGCAGAGCAGTATTGTGGG - Intergenic
992100210 5:73400511-73400533 GAGGAGAGGGGCAGCATTGCAGG - Intergenic
993163618 5:84321382-84321404 TAGATGCAGAGCAGCATTCTGGG + Intronic
993404583 5:87495244-87495266 GAGGTAAGAGGCAGCCTTCTTGG + Intergenic
995059825 5:107801814-107801836 GAGGGGCAGGGAAGCCTTCTGGG - Intergenic
995280645 5:110331746-110331768 AAGGGGAAGGGCAGCTCTCTGGG - Intronic
995486791 5:112647675-112647697 GAGGTGGGGGGAGGCATTCTGGG - Intergenic
998214458 5:140226945-140226967 GAGGTGGAGAGCAGCAGTGTGGG + Intronic
1000463673 5:161549620-161549642 GAGGGGAAGGGGAGCATTTTAGG - Intronic
1001748927 5:174112959-174112981 GAGCTGGAGGCCATCATTCTCGG - Intronic
1002478341 5:179482797-179482819 GAGGAGAAGGGCAGAACTCTGGG - Intergenic
1002651331 5:180697973-180697995 GACGTGAGAAGCAGCATTCTGGG + Intergenic
1003252025 6:4437186-4437208 GAAGTGACGGGCAGCCTTGTGGG + Intergenic
1005585098 6:27268656-27268678 GAGGTCAAGGTCAGGATCCTCGG + Intergenic
1005750384 6:28876414-28876436 GAGGTGAGAGGCAGCGTGCTGGG + Intergenic
1006202071 6:32302651-32302673 TAGGTTAATGGCAGCATTTTTGG + Intronic
1007129047 6:39452402-39452424 GAAGTGAAAGGCAGCTTCCTGGG - Intronic
1007533467 6:42563970-42563992 GAGGGGAAGCGGAGCTTTCTGGG - Intergenic
1009927240 6:70134925-70134947 GAAGTGGAAGGCAGCATTGTGGG - Intronic
1010494165 6:76513531-76513553 CAGGTGAAAGGGAGCATTCGGGG + Intergenic
1010534489 6:77011138-77011160 TAGGTGAAGGGAAACATCCTGGG - Intergenic
1011531194 6:88322713-88322735 AAGGGGAAGGGAAGCTTTCTGGG + Intergenic
1012894937 6:104937338-104937360 GGGGTGCAGGGCCGCAGTCTCGG + Intergenic
1015571409 6:134624948-134624970 GAGGTGCAGGACAGCACTGTGGG - Intergenic
1018743336 6:166746603-166746625 GAAGTGAGGGGTAGCCTTCTGGG - Intronic
1021300248 7:18963974-18963996 AAGTTGAAGGGCAGGATTGTTGG - Intronic
1022446507 7:30475030-30475052 GAGGTCATAGGCAGCAATCTGGG + Intronic
1022728663 7:33003053-33003075 GAGGTGTAGGGCATGATTCCAGG + Intronic
1022986321 7:35657827-35657849 GAGGTGAATGGCAGGAACCTGGG + Intronic
1023235119 7:38077866-38077888 GTGGTGAAAGGAAGCATCCTTGG - Intergenic
1023793517 7:43772120-43772142 CAGGTGAAGGGCAGGCTTCAGGG + Intronic
1023835661 7:44065833-44065855 GGCGTGAAGGGCAGAAGTCTGGG + Intronic
1024604605 7:51013444-51013466 GCAGGGAAGGGCAGCCTTCTTGG + Intergenic
1026869292 7:73840977-73840999 GAGGTGTGGGGCAGGGTTCTGGG + Intronic
1030498368 7:110328456-110328478 AAGGTGAAGGACAAGATTCTAGG + Intergenic
1034471101 7:151254746-151254768 GAGGTGAGGGGCAGGACGCTGGG - Intronic
1036011359 8:4728863-4728885 GAGGGGAAGGGGAGAATTATTGG + Intronic
1036218713 8:6902624-6902646 GAAGTGCAGGCCACCATTCTTGG + Intergenic
1037578785 8:20232317-20232339 GAGATGAAGGGCAGCTTCGTGGG + Intergenic
1038302872 8:26370890-26370912 GAGATGAAGGGGAGCAGTCCAGG - Intronic
1038792238 8:30678309-30678331 GAGGTGAAGTGCATCAAACTTGG - Exonic
1038936753 8:32260404-32260426 GAGGTGAAGGGTGGAATTATTGG - Intronic
1039752993 8:40495196-40495218 GAGGTGCAGGGCCCCATGCTGGG + Intergenic
1041865320 8:62566386-62566408 AAGGTGAATGGCAGAATTCTTGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043158775 8:76819519-76819541 GAGGTGAAATGGAGCATTCGTGG + Intronic
1044533101 8:93330372-93330394 GCGGTAAAGGGCAGGCTTCTTGG - Intergenic
1047205911 8:122802915-122802937 GGGATGCAGGGGAGCATTCTCGG - Intronic
1048452909 8:134549719-134549741 GAGAAGAAGGTGAGCATTCTAGG - Intronic
1050560240 9:6827928-6827950 GAGGTGATGGACAGCTTTATTGG + Intronic
1051714362 9:19965911-19965933 GAGATGTAGGGCAGGTTTCTTGG - Intergenic
1052574462 9:30274326-30274348 GAGATTAAGGGCCACATTCTTGG + Intergenic
1053877561 9:42559568-42559590 GGGGTCAAGGGCAGCATACAGGG + Intergenic
1053895093 9:42734809-42734831 GGGGTCAAGGGCAGCATACAGGG - Intergenic
1054234133 9:62542126-62542148 GGGGTCAAGGGCAGCATACAGGG - Intergenic
1056831920 9:89924185-89924207 AAGGTGAAGGTCAGCCTCCTAGG - Intergenic
1057357259 9:94341969-94341991 CAGGTGAAGGGCAGTAATCCAGG - Intergenic
1057650493 9:96915657-96915679 CAGGTGAAGGGCAGTAATCCAGG + Intronic
1057754104 9:97817557-97817579 GATGTGTAGTGCAGCATTCCTGG + Intergenic
1058457132 9:105147993-105148015 GAGGTGAAGGGATGAATTGTAGG - Intergenic
1059285142 9:113165963-113165985 GAGGTCAAGGTGAGCATTCTGGG - Exonic
1059561049 9:115334805-115334827 GAGGTCAAGGGTAGATTTCTAGG - Intronic
1061039960 9:128135550-128135572 GATGCGAAGGGCAGCCTGCTTGG - Intergenic
1061510884 9:131060205-131060227 CATGTGAAGGCCAGAATTCTGGG + Intronic
1062086639 9:134652586-134652608 GGGGTGCAGAGCAGCATCCTCGG - Intronic
1203772395 EBV:56237-56259 CACGTGCAGGGCCGCATTCTTGG + Intergenic
1186286182 X:8046424-8046446 GAGGTCATGGGGAGCATTTTTGG + Intergenic
1188297169 X:28463547-28463569 AAAGGGAAGGGCAGCATTATTGG - Intergenic
1188678213 X:32969060-32969082 GAGGGGAAAGGGAGCGTTCTAGG - Intronic
1189554835 X:42131389-42131411 CAGGTGAAGGGCTGCAGTGTAGG + Intergenic
1190413597 X:50160634-50160656 GGGGTGCAGTGGAGCATTCTCGG - Intergenic
1190470196 X:50770841-50770863 GAGGCCAAGAGCATCATTCTTGG + Intronic
1190967330 X:55313200-55313222 GAGGTGAGGGGAAGCATTGATGG - Intergenic
1192709785 X:73567847-73567869 GAGGTGAATATTAGCATTCTAGG - Intronic
1193497514 X:82232781-82232803 GAGGAGCAGGGCAGCCTGCTTGG - Intergenic
1193527391 X:82610584-82610606 GAAGTCAAGGGAAGCATTCCAGG - Intergenic
1196433205 X:115649819-115649841 AATGTCAAGGGCAGCATTCTAGG - Exonic
1197804552 X:130386419-130386441 GAGGAGATGAGCTGCATTCTGGG + Intergenic
1200002439 X:153068959-153068981 GATGAGAAGGGTAGCAGTCTTGG + Intergenic
1200005285 X:153081051-153081073 GATGAGAAGGGTAGCAGTCTTGG - Intergenic