ID: 924133530

View in Genome Browser
Species Human (GRCh38)
Location 1:240938187-240938209
Sequence AAAAATCCACAGATGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 423}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924133530_924133537 7 Left 924133530 1:240938187-240938209 CCCTCCCACATCTGTGGATTTTT 0: 1
1: 0
2: 2
3: 28
4: 423
Right 924133537 1:240938217-240938239 GGTGGTTGAATCCACAGATGTGG 0: 2
1: 79
2: 205
3: 411
4: 632
924133530_924133539 25 Left 924133530 1:240938187-240938209 CCCTCCCACATCTGTGGATTTTT 0: 1
1: 0
2: 2
3: 28
4: 423
Right 924133539 1:240938235-240938257 TGTGGAAGTCATAAATAGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 237
924133530_924133540 26 Left 924133530 1:240938187-240938209 CCCTCCCACATCTGTGGATTTTT 0: 1
1: 0
2: 2
3: 28
4: 423
Right 924133540 1:240938236-240938258 GTGGAAGTCATAAATAGAGAGGG 0: 1
1: 0
2: 2
3: 29
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924133530 Original CRISPR AAAAATCCACAGATGTGGGA GGG (reversed) Intronic
900750202 1:4390909-4390931 AAGATTCCACAAATGTGGGTGGG - Intergenic
903293328 1:22328539-22328561 AGAAATGCCCCGATGTGGGATGG - Intergenic
903329059 1:22587863-22587885 GAAAATGCACAGATCTGGGCAGG - Intronic
903742409 1:25565864-25565886 ACAAAGCCCCTGATGTGGGAGGG - Intronic
904512425 1:31023407-31023429 TAGAATCCACAGCTCTGGGAGGG - Intronic
904999575 1:34657771-34657793 AAACACCCAAGGATGTGGGAAGG - Intergenic
910014318 1:82502531-82502553 AAAAATCAATGGATGTGAGATGG + Intergenic
910434543 1:87191833-87191855 AAAAATGCACAGATTGTGGAGGG - Intergenic
911002740 1:93182256-93182278 AAAAATTCTCAGATGTAGGGAGG - Intronic
911531017 1:99043119-99043141 AAATATCCACAGGTGTGGAGGGG + Intergenic
912076976 1:105887109-105887131 AAAAATCCACAAATTTAGGTGGG + Intergenic
912588013 1:110784422-110784444 ACAAATGCACAGAAGTGTGAAGG + Intergenic
912642578 1:111361431-111361453 AAATACCCACAGATGTGGAGGGG - Intergenic
912967958 1:114252916-114252938 GAAAACCCTCAGAAGTGGGATGG + Intergenic
913295124 1:117311816-117311838 AAAATTCCAGAGATGTGTTATGG + Intergenic
914577321 1:148986302-148986324 AAAAATACACAGCTTTGGTAGGG - Intronic
915628011 1:157128078-157128100 AAAGGTACACAGATATGGGATGG + Intronic
915833299 1:159151663-159151685 AAAAATCCATAGAAGTGGCCGGG + Intergenic
916039072 1:160946917-160946939 AAATACCCACAGATGTGGAGGGG - Intronic
916514251 1:165500327-165500349 CAAAATACACATATGTGGGTGGG + Intergenic
916577028 1:166076525-166076547 AATAAAGCAGAGATGTGGGATGG - Intronic
917037901 1:170769240-170769262 AAAACACAACAGATGTGTGATGG + Intergenic
917068679 1:171125448-171125470 AAACATCCTCAGACTTGGGATGG + Intergenic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917155988 1:171999638-171999660 AAATATTCACAGGTATGGGATGG - Intronic
917320863 1:173780148-173780170 AAAAAGCCACAGATATGTGAAGG - Intronic
918127853 1:181600108-181600130 AGAAATCTGCAGAAGTGGGAGGG + Intronic
918850393 1:189680455-189680477 AAAAATGAACTGATCTGGGAAGG + Intergenic
919787107 1:201265696-201265718 AAAAATCAAGAGGTGGGGGAAGG - Intergenic
921320159 1:213930938-213930960 AAGAATGCACAGCTTTGGGAAGG - Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
923453709 1:234143872-234143894 ATAAATACCCAGAAGTGGGATGG + Intronic
923725937 1:236505489-236505511 AAATATCCACAGGTGTGGAGGGG + Intergenic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924829963 1:247582963-247582985 AAATACCCACAGATGTGGAGGGG + Intergenic
1064917307 10:20474272-20474294 AAGAAACCACAGATGTGCAAAGG + Intergenic
1065457046 10:25917560-25917582 ATATATGCACAGATGTGGGCAGG - Intergenic
1065809416 10:29427703-29427725 AAATACCCACAGGTGTGGAAGGG + Intergenic
1066527985 10:36302335-36302357 AAAAATCCAAAGGTGTGCAATGG - Intergenic
1066782030 10:38961410-38961432 AAAAATACACAGAAGTGTAAGGG + Intergenic
1066950550 10:42112327-42112349 AAAAAGCCACGGCTGCGGGAGGG + Intergenic
1067484391 10:46633934-46633956 AAAAAACGACAGATGTTGGTAGG - Intergenic
1067610369 10:47707712-47707734 AAAAAACGACAGATGTTGGTAGG + Intergenic
1069487435 10:68833063-68833085 AAAAACCCACAGAAGTGGCTAGG - Intronic
1069986272 10:72286375-72286397 GAAAATCCCCCGATGGGGGAAGG - Intergenic
1070053328 10:72910353-72910375 AAAAATACACAGATGTATAATGG + Intronic
1070919556 10:80175758-80175780 AAAAATACACAGATGTCGGCTGG + Intronic
1071625781 10:87167970-87167992 AAAAAACGACAGATGTTGGTAGG + Intronic
1071916758 10:90301668-90301690 AAAAACCCACAGGTGTGGAGGGG - Intergenic
1072039119 10:91590809-91590831 AGCAAGCCACAGATGTGGGCTGG - Intergenic
1072410433 10:95197209-95197231 AAATACCCACAGATGTGGAGGGG - Intronic
1072747687 10:97952899-97952921 ATATATTCACAGATGTGGAAGGG - Intronic
1073298253 10:102454390-102454412 AAAAACCCACAGGTGTGGAGGGG - Intergenic
1073822034 10:107274950-107274972 AAAGATACTCAGGTGTGGGAGGG + Intergenic
1075377430 10:121990101-121990123 AAAAATCCACAGAAGGTTGAAGG - Intronic
1075996592 10:126881850-126881872 AAAAATACAAAGAGGTTGGAGGG + Intergenic
1076371833 10:129960181-129960203 AAAATTCCACGGAAGGGGGAGGG + Intronic
1077274106 11:1695401-1695423 AGAAAGCCAAAGCTGTGGGAGGG - Intergenic
1077563356 11:3280164-3280186 AAAAACCAACAGATGTGGCCAGG - Intergenic
1077569248 11:3325979-3326001 AAAAACCAACAGATGTGGCCAGG - Intergenic
1077585356 11:3447441-3447463 AAATACCCACAGGTGTGGAAGGG - Intergenic
1078036241 11:7808030-7808052 CATAATCCCCACATGTGGGAGGG - Intergenic
1078801825 11:14653374-14653396 AAAAATCCACAAATCAGGCAAGG + Intronic
1080058803 11:27934937-27934959 ACAAATCCACAGAAGCCGGAAGG + Intergenic
1081273831 11:41121953-41121975 AAAAATCCACACAAATGGTAGGG + Intronic
1083045037 11:59726830-59726852 AAAAATCAACAAATGTGTGATGG + Intronic
1083467519 11:62858533-62858555 AAACATCCACAGGTGTGGAGGGG - Intronic
1084500970 11:69534976-69534998 AAAAATCCACAGAGATGTAAAGG + Intergenic
1084668549 11:70591718-70591740 TAAAATGCAGAGATGTGGGCCGG + Intronic
1086548325 11:88025527-88025549 AAAAAACAACAGATTTGGCAAGG - Intergenic
1086747810 11:90452260-90452282 AAAAACTTACAGAGGTGGGAAGG + Intergenic
1087502598 11:98977375-98977397 AAAAATTAACAGATGTTGGTGGG + Intergenic
1088377764 11:109160577-109160599 AGATATCCAAAAATGTGGGAGGG - Intergenic
1090336734 11:125973570-125973592 AACCATCCACAGATGTGCCATGG + Intronic
1090852421 11:130582204-130582226 AGAAAACCACAGCTCTGGGAGGG + Intergenic
1091072914 11:132585916-132585938 AAACATCCACACATTTGGAAAGG + Intronic
1092455171 12:8636572-8636594 AAACACCCACAGATGTGGAGGGG + Intergenic
1094422814 12:30289825-30289847 AACAATGGACAGATGTGTGAGGG - Intergenic
1094430275 12:30360625-30360647 AAAAATTCACAGATCTGGCAGGG - Intergenic
1096329142 12:50694036-50694058 AAAAATTAACAGATGTAGGCAGG + Intronic
1097396539 12:59081822-59081844 AAAAATCTACAAATGTGTCAAGG + Intergenic
1099035426 12:77581208-77581230 AAAAAGCAATAGATGTGGGATGG - Intergenic
1099185591 12:79512677-79512699 AAAAAAACAAAGATATGGGAAGG - Intergenic
1100000594 12:89830248-89830270 AAAAAGCCTCTGCTGTGGGAGGG + Intergenic
1100037447 12:90270060-90270082 TAAAATCCACATGTGTGGGCTGG - Intergenic
1100707261 12:97214815-97214837 AAACATTCACAGAGCTGGGAGGG + Intergenic
1100799977 12:98220896-98220918 AAAAATCCACAGTGGTGTGCTGG - Intergenic
1101382169 12:104223631-104223653 AAAAATCCTTACCTGTGGGAAGG + Intronic
1102392991 12:112564427-112564449 AAAAATCCACATGCGTGGGGAGG - Intergenic
1102621660 12:114200700-114200722 AAAATTGTACAGATGGGGGATGG - Intergenic
1102663063 12:114546456-114546478 AGAGATCCACAGATCTGGAAAGG - Intergenic
1106513039 13:30428026-30428048 AGAAATCCGCAAATGTGGAATGG + Intergenic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1107197772 13:37674331-37674353 GAAATTAAACAGATGTGGGATGG - Exonic
1107690783 13:42950859-42950881 AAAAATCCAAAGAGGTGGCTGGG + Intronic
1108300660 13:49071525-49071547 AAAAAATAACAGATGTGGGGAGG - Intronic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1111552891 13:89838856-89838878 AAAAAACTACATGTGTGGGATGG + Intergenic
1111746329 13:92274348-92274370 GAAAATACACAGAGGTGAGAAGG - Intronic
1112646942 13:101344115-101344137 AAGAAATCACAGATGTGGTATGG - Intronic
1112676876 13:101711777-101711799 AAAAATGCACAGAAGGGAGATGG + Exonic
1113331063 13:109328249-109328271 GACACTTCACAGATGTGGGAAGG - Intergenic
1114006625 14:18320438-18320460 AAATACCCACAGATGTGGAGGGG + Intergenic
1114287499 14:21259098-21259120 AAGAATACATAGATGAGGGATGG - Intronic
1114334495 14:21674123-21674145 AAAAATACAGAGATGAGAGAAGG + Intergenic
1115051123 14:29064777-29064799 AATAATCCAGAGATGTGGTCTGG - Intergenic
1115280033 14:31651358-31651380 AAATATCCAAAGATCTGGGCAGG - Intronic
1115762207 14:36585648-36585670 ATAAATTCACAGACATGGGAGGG + Intergenic
1115995434 14:39190842-39190864 CAAGATCCACAGATGTAAGAAGG - Intergenic
1116215783 14:42015654-42015676 AAAAAGGGACAGATGTGGGTTGG - Intergenic
1116498171 14:45587743-45587765 AGAAATCCAAATATGTAGGAAGG + Intergenic
1116632660 14:47355143-47355165 AAAAATAAGCAGATGTGCGAGGG - Intronic
1116705580 14:48294648-48294670 AAAAATCCATAGGTATGGGCCGG + Intergenic
1118968485 14:70610833-70610855 AAAGAGTCACAGAAGTGGGAGGG + Intergenic
1119350915 14:73964776-73964798 AAAGATCCAAAGATTTTGGAAGG + Exonic
1120686477 14:87543631-87543653 AAAACTACACAGATGTTGTAAGG - Intergenic
1121513277 14:94529999-94530021 AAAAATGGACAGTTGAGGGAAGG + Intergenic
1123823829 15:24060955-24060977 AAAAATCCACAGAATAGGTATGG - Intergenic
1124556390 15:30729598-30729620 GAAAATGCAGAGATGTGTGAGGG - Intronic
1124674885 15:31676170-31676192 GAAAATGCAGAGATGTGTGAGGG + Intronic
1125116656 15:36101304-36101326 CATAATCCCCACATGTGGGAAGG - Intergenic
1125321966 15:38498641-38498663 TAAAATCCAAAACTGTGGGAGGG + Intronic
1125397739 15:39268854-39268876 ACAAAAGCACAGATCTGGGATGG + Intergenic
1127284426 15:57520000-57520022 AGAGATCCACAGATGGGGGTGGG - Intronic
1127640581 15:60912268-60912290 AAAAATAGCCAGATGTGGGGGGG + Intronic
1128418713 15:67471100-67471122 AAAAATCTACCGATGGGGGAAGG - Intronic
1128747997 15:70128255-70128277 AAAAATCCCCATTTGTGGGCTGG + Intergenic
1131106496 15:89738260-89738282 AGACAACCTCAGATGTGGGAGGG - Intronic
1131111823 15:89769207-89769229 TAAAATCAGCACATGTGGGAGGG - Intronic
1131365451 15:91835172-91835194 AAAAGTCCACGGAGGTGGGTTGG - Intergenic
1131774929 15:95784736-95784758 AAACACCCACAGGTGTGGAAGGG - Intergenic
1132718732 16:1305531-1305553 AAAAATTCACATATCTGAGAAGG - Intergenic
1132795882 16:1722298-1722320 AGAAAACCACAGAGGCGGGAGGG - Intronic
1133014165 16:2931326-2931348 AAAAATACATAAATGTGGGCTGG + Intronic
1133894646 16:9914841-9914863 AACATTCCCCACATGTGGGAAGG + Intronic
1134630790 16:15754505-15754527 AAAAATCCACTGATGAAGTAGGG + Intronic
1136922537 16:34344578-34344600 ACAAAAGCACAGAGGTGGGAGGG - Intergenic
1136982036 16:35067228-35067250 ACAAAAGCACAGAGGTGGGAGGG + Intergenic
1137332466 16:47512686-47512708 AACAATACACTGATGTGAGAGGG - Intronic
1138687995 16:58742879-58742901 AAAACTGCACACATGTGGGCCGG + Intergenic
1139256874 16:65551023-65551045 AAAAACCCACAATTGGGGGAAGG - Intergenic
1140239598 16:73189155-73189177 AGAAATACCCAGATGTGGGCGGG - Intergenic
1141932066 16:87212137-87212159 AAACATCCACAGTCGTGGGTGGG - Intronic
1141994777 16:87629405-87629427 AAAAACCCACAAAGATGGGATGG - Intronic
1142746694 17:1962873-1962895 AAAAAAAAAGAGATGTGGGAAGG + Intronic
1143325101 17:6093480-6093502 CACAATCCAGAGATGGGGGAGGG - Intronic
1144031621 17:11328257-11328279 CAAAGCCCACAGAGGTGGGAGGG - Intronic
1146070531 17:29676909-29676931 AAAAATCCACAAATTAGGGTAGG + Intronic
1146451594 17:32978901-32978923 AAAAATGCACAGGTTGGGGACGG - Intronic
1147426694 17:40349113-40349135 AGCTATCCCCAGATGTGGGACGG + Intronic
1148062712 17:44847789-44847811 AAAAGTCCACAGATGGTGGTGGG - Intronic
1148877200 17:50696437-50696459 AAAAACCCAGAGATGTATGAAGG + Intronic
1149081308 17:52660958-52660980 AAGATTCCACAGAAGTGAGAGGG - Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1149736783 17:59002530-59002552 AAAAATCAACTGATGTGGCCAGG - Intronic
1151574265 17:74943713-74943735 AAAAATCCACAGGTATGGAAAGG + Exonic
1153149210 18:2070904-2070926 ACAAATCTACAGAGGTGGAAAGG - Intergenic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1154318751 18:13327258-13327280 AATATTGCACAGCTGTGGGAAGG - Intronic
1156235118 18:35195765-35195787 AGAAATCCACAGATATAGGAGGG + Intergenic
1156468659 18:37363807-37363829 AGAAAGGCACAGATGTGGGAGGG - Intronic
1157131038 18:45007603-45007625 AAAAATTCACAGCTGTGAGATGG - Intronic
1157406627 18:47427319-47427341 AAAAAGACACAGATATGGTAGGG - Intergenic
1157650743 18:49327862-49327884 TACAGTCCACAGATGTTGGATGG + Intronic
1159091412 18:63853297-63853319 AAATACCCACAGGTGTGGAAAGG + Intergenic
1159847938 18:73488914-73488936 AAAAATCTACAAATGTGTTACGG + Intergenic
1160525826 18:79535393-79535415 AACAAACCACATTTGTGGGATGG - Intergenic
1160593823 18:79961026-79961048 AAACATCCACAGGTGTGGAGGGG + Intergenic
1161752287 19:6106997-6107019 AAAAATCCACAGGTGCCGGCCGG + Intronic
1164154438 19:22581722-22581744 AAACACCCACAGGTGTGGAAGGG + Intergenic
1164730824 19:30502871-30502893 AATAAACCCCAGATGTGGCAAGG + Intronic
1165498325 19:36167626-36167648 AAAACTTCACTGAGGTGGGAGGG + Intergenic
1165912172 19:39236363-39236385 ATAATTCCAGTGATGTGGGAGGG + Intergenic
1166157145 19:40922217-40922239 AAATACCCACAGGTGTGGGGGGG - Intergenic
1166498372 19:43322935-43322957 CAAAAGGCACAGCTGTGGGATGG - Intergenic
1166535333 19:43570486-43570508 AAGAACCCACAGATGTGGCCAGG + Intronic
1167818677 19:51906624-51906646 AAACACCCACAGATGTGGAGAGG + Intronic
1167824515 19:51960256-51960278 AAATATCCACAGGGGTGGAAGGG - Intergenic
1167860920 19:52283371-52283393 AAAAATCCAGATAGGTGGGAAGG + Exonic
1167915983 19:52740453-52740475 AAATATCCACAGGTGTGGAGTGG - Intergenic
1168003665 19:53468348-53468370 AAATACCCACAGGTGTGGAAGGG - Intronic
1168249131 19:55131493-55131515 GCAAATCCACAGAAGTAGGAAGG - Intergenic
1168502447 19:56904798-56904820 AAAAACCAATAGATGTTGGAGGG - Intergenic
925554939 2:5120641-5120663 AAAAACCCACAGACGAGAGAAGG - Intergenic
925572203 2:5324705-5324727 AAAAAGCCAGAGGTGGGGGAGGG - Intergenic
926676304 2:15624633-15624655 CATAATCCCCACATGTGGGAGGG - Intronic
927265015 2:21136721-21136743 AAAAATCCACAGATTAGCTATGG + Intronic
927754995 2:25701546-25701568 AAAAAAGCACAGATCTGGAAAGG + Intergenic
928227872 2:29469227-29469249 ACATGTCCACAGATGTGGAATGG - Intronic
931100793 2:58998756-58998778 TATAATCCCCAGGTGTGGGAGGG + Intergenic
932394177 2:71428423-71428445 AAAAATACCCAAATTTGGGAGGG - Intronic
933817297 2:86078608-86078630 AGAAATGTACTGATGTGGGAAGG - Intronic
934944554 2:98529438-98529460 AAAAAACCACAGAATTGGGCTGG + Intronic
935007546 2:99094745-99094767 AAAAACCAACAGATGTTGGTGGG + Intronic
938476681 2:131621764-131621786 AAAAAACAACAGATGTTGGGTGG - Intergenic
938632627 2:133184615-133184637 AAAAAATAACAGATGTTGGAGGG - Intronic
939115638 2:138057112-138057134 TAAAAGACACAGAAGTGGGAAGG - Intergenic
939376129 2:141370297-141370319 AAAAATTAACAGATGTTGGAAGG - Intronic
939504916 2:143033342-143033364 AAAAACGCAAAGATGTGGGAAGG - Intronic
939716980 2:145596120-145596142 AAATATCAGCAGAAGTGGGAGGG - Intergenic
941569289 2:167149401-167149423 AAAAATCAACAAGTGTAGGAAGG + Intronic
942853159 2:180514658-180514680 CAAAATCCACAGCTATGGCAGGG + Intergenic
943256180 2:185596254-185596276 CATAATCCCCACATGTGGGAGGG + Intergenic
943324312 2:186479816-186479838 AAAAATCCCCAGATGTATCAGGG + Intergenic
943715929 2:191151776-191151798 AAAAGACCACTGAAGTGGGAAGG - Intergenic
944127591 2:196312038-196312060 TAAAATCAACATATGTGGGAAGG + Intronic
944149430 2:196541809-196541831 AAAAATCTTCAGGTGTTGGAAGG - Intronic
944498202 2:200329722-200329744 AAAGATCCACAGACGTGGCAAGG - Intronic
944582069 2:201139930-201139952 AAAAACCCACAGGTGTGGAGGGG + Intronic
946019137 2:216627970-216627992 AAAAAACAACAGATGTTGGCAGG - Intergenic
947101853 2:226629780-226629802 AAAAATGCACACATGTGCTAAGG - Intergenic
948748869 2:240116647-240116669 AATAATACACAGCAGTGGGAAGG - Intergenic
1169109637 20:3023860-3023882 AAACATCCACAGGTGTGGAGGGG + Intronic
1170268986 20:14502820-14502842 AAAAATCCTCAGATTTTTGAGGG - Intronic
1170339041 20:15302633-15302655 ATAAATCCCCAGTTGGGGGATGG + Intronic
1170778390 20:19401232-19401254 ACGAGTCCACAGAAGTGGGATGG + Intronic
1170866371 20:20161406-20161428 ACAAATCCACAAAGGTGAGATGG + Intronic
1171276499 20:23860613-23860635 AAACACCCACAGGTGTGGGGGGG - Intergenic
1171291095 20:23983572-23983594 AAACACCCACAGATGTGGAGGGG + Intergenic
1171338713 20:24410327-24410349 TAAAATCCTCAGCTGGGGGAAGG + Intergenic
1172422480 20:34828976-34828998 ATAAATCTAGAGATGTGGGGAGG - Intergenic
1173306721 20:41857521-41857543 AAAAATACAGAGATGTTGGGAGG + Intergenic
1173837212 20:46133851-46133873 AAAAATCCACAAAAGTGGCCGGG + Intergenic
1174026610 20:47581947-47581969 AAAAATTATCAGATGAGGGAGGG - Intronic
1174635385 20:51995149-51995171 AAAAAGCCATGTATGTGGGAAGG + Intergenic
1175213940 20:57380163-57380185 AAACATCCACAAAAGTGGAAAGG + Intergenic
1175776576 20:61657631-61657653 AAAGATCTACAGAAGTTGGATGG + Intronic
1177071354 21:16512673-16512695 AAAAATCCAAAAATGTTGGTTGG - Intergenic
1177221126 21:18194318-18194340 ATGAAGCCACAGATGTGGGCAGG - Intronic
1177456201 21:21343253-21343275 AACAATCTAGAGGTGTGGGAGGG + Intronic
1177501594 21:21963990-21964012 AATAATTCTCAGCTGTGGGAAGG + Intergenic
1180431134 22:15251249-15251271 AAATACCCACAGATGTGGAGGGG + Intergenic
1180742208 22:18061580-18061602 AAAAATAGGCAGAGGTGGGAAGG + Intergenic
1181308444 22:21930331-21930353 ACACATCCCCAGAAGTGGGATGG - Intronic
1181400864 22:22649363-22649385 AAACACCCACAGATGTGGAGGGG - Intergenic
1181702846 22:24630461-24630483 AAACACCCACAGATGTGGAGGGG - Intergenic
1182918728 22:34059895-34059917 AAAAAACCAAGGCTGTGGGAGGG + Intergenic
1183438385 22:37808484-37808506 TGAAATCCACAGATGTGAAATGG + Intronic
1183864237 22:40691489-40691511 AAAAAACCACATCTGTGGGTTGG - Intergenic
1185285020 22:49996240-49996262 CAACAGCCACAGAGGTGGGAGGG - Exonic
949405355 3:3708147-3708169 AAAAATACGCAGATCTGGGTAGG + Intronic
949804754 3:7942660-7942682 AAATACCCACAGATGTGGAGGGG + Intergenic
949964879 3:9347145-9347167 AAAAAGCAACAGAGTTGGGAGGG - Intronic
950214011 3:11145089-11145111 AGTAATCCACAGATGGGGTATGG - Intronic
950257947 3:11521368-11521390 ATAAACCCAAAGATGAGGGAGGG + Intronic
950287785 3:11758644-11758666 AAAAATACACAGATCTGGCCGGG - Intergenic
950762867 3:15249365-15249387 AAATATCCACAAATATGTGAAGG - Intronic
950818150 3:15729268-15729290 ACAAAGACACAGAGGTGGGAAGG - Intronic
951188609 3:19743176-19743198 TAAAATCCAGAGAAGAGGGAGGG + Intergenic
951690055 3:25385922-25385944 CAGAATCCAGAGATCTGGGAGGG + Intronic
952211911 3:31236319-31236341 AAAAAGCCAAAGATGTGCGTTGG - Intergenic
952486008 3:33810879-33810901 AAAAATCCACAAACATGAGAAGG - Intronic
952549900 3:34464998-34465020 AAACATGCAAAAATGTGGGAAGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953283737 3:41583857-41583879 AAAGGTACACAAATGTGGGATGG + Intronic
954791976 3:53140006-53140028 AGAAAGCCACAGAGGTGGCAGGG - Intergenic
954884394 3:53859114-53859136 AAAAAGCCAAAGATGTAAGATGG + Intronic
955106187 3:55900766-55900788 GATAGTCAACAGATGTGGGAGGG + Intronic
955554940 3:60126787-60126809 GAAAATCCCCAGATCTGGCATGG - Intronic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
956885280 3:73553165-73553187 AAAAATGCACCAATATGGGAAGG + Intronic
957490544 3:80921452-80921474 ATAAATCCACAGGTCTAGGAGGG + Intergenic
957703259 3:83746220-83746242 AAAAAGACAGAGATTTGGGAGGG + Intergenic
958579034 3:95991922-95991944 AAAAATAAAAAGATGTAGGAGGG + Intergenic
959974382 3:112442034-112442056 AAAAAACAACAGATGTTGGTGGG + Intergenic
959985200 3:112564095-112564117 AAACACCCACAGATGTGGAGGGG - Intronic
960728503 3:120697071-120697093 AAAAAGCTCCAGCTGTGGGACGG + Intronic
960883869 3:122374640-122374662 TAAAACCCATAGATATGGGAGGG + Intronic
961191732 3:124968052-124968074 AATATCCCACAGATGGGGGAAGG - Exonic
961338552 3:126201021-126201043 TAAAATACACAGAAGTGGAATGG - Intergenic
961615618 3:128177405-128177427 TAAAATCCAGAGATGCGGGTGGG - Intronic
962061738 3:131935135-131935157 AAAAAATCACACATGGGGGAAGG - Intronic
962371850 3:134827333-134827355 CAAAATCAACAGATGTGCGCGGG + Intronic
962512987 3:136120923-136120945 AAAAAATCACAGATGTTGGCAGG + Intronic
962529990 3:136270479-136270501 AAAAAACAACAGATGTGGCCGGG - Intronic
963911930 3:150822336-150822358 AAAAAATCACTGATGTGGCATGG - Intergenic
965024755 3:163286395-163286417 AAAAATCCAAGGTTTTGGGAAGG + Intergenic
966319152 3:178681380-178681402 ATAAATCCACAGATGTTGTCAGG - Intronic
967958696 3:194900978-194901000 AAAAATCATCAGATGGGGGCAGG + Intergenic
969547387 4:7840179-7840201 AAACATTCACTGATGTAGGAAGG + Intronic
969617421 4:8261903-8261925 AAGAATCCACGGAAGTGGAAAGG + Intergenic
969801256 4:9567329-9567351 AAATACCCACAGGTGTGGAAGGG - Intergenic
970336518 4:15051138-15051160 AAAAATCCACAAAGGATGGATGG - Intronic
971693671 4:29870313-29870335 TAAAATACAATGATGTGGGAGGG + Intergenic
972257201 4:37369879-37369901 AAATATGCACAGATATGGGATGG + Intronic
973312666 4:48726384-48726406 AAATTTCCACAGATGCGGGCGGG + Intronic
974221914 4:58986091-58986113 AAAATTCCAAAGAAGTGGGTGGG - Intergenic
974447868 4:62010049-62010071 AAACATCTACATGTGTGGGAGGG - Intronic
974827177 4:67146188-67146210 AAAGAACCACAAATGTAGGAAGG + Intergenic
976156031 4:82145512-82145534 AAAAAAAAACAGATGTGGGCCGG - Intergenic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976516156 4:85969630-85969652 AAAAAACCACAGCTTGGGGAAGG - Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
978184320 4:105839123-105839145 AAATATGCACAGATATGGAAAGG + Intronic
978478082 4:109154992-109155014 AAAGATCCAAATATATGGGAGGG - Intronic
979268468 4:118731761-118731783 AAAGATGCACAAAAGTGGGATGG + Intronic
979593114 4:122503272-122503294 AAAATACCACAGAAGTGGGTTGG - Intergenic
980344437 4:131594408-131594430 AAAAATCTACAGAGATGGAAAGG - Intergenic
981098581 4:140806707-140806729 GTAAATCCACAGATCTGGGATGG - Intergenic
982512770 4:156304777-156304799 AAACACCCACAGGTGTGGAAGGG - Intergenic
982831315 4:160064209-160064231 AAAAAACAACAGATGTTGGCAGG - Intergenic
982900468 4:160993525-160993547 CATAATCCCCACATGTGGGAAGG - Intergenic
982942683 4:161578079-161578101 ACAAATTAACAGATGTGAGAAGG + Intronic
983426265 4:167587711-167587733 AAGAATCCACAGCTTTGTGATGG - Intergenic
983744598 4:171182243-171182265 AAAAATCCATAGATTTGGTCGGG + Intergenic
983970329 4:173863819-173863841 CAGAATCCACAGAGGTGAGATGG - Intergenic
985031322 4:185793692-185793714 AAAAATCCCCAGAGATGGAAAGG - Intronic
985691677 5:1316418-1316440 ATAAAACCACAGGTGTGGAAGGG + Intergenic
985873021 5:2573147-2573169 AAAAAATCACAGAGGTTGGAAGG + Intergenic
986210873 5:5670802-5670824 AAGAAACAACAGATGTTGGAGGG - Intergenic
987175743 5:15306675-15306697 AAAAAACAACAGATGTTGGTGGG - Intergenic
987571511 5:19668106-19668128 AAAAATTCACATATTTGAGATGG + Intronic
988255859 5:28819346-28819368 AAAAATCTAAAGATGTGGCTAGG + Intergenic
988447672 5:31305939-31305961 AAAAAAACACAAATTTGGGAAGG + Intronic
988717133 5:33839444-33839466 AGTAATGCACAGATGTGGAAAGG - Intronic
989188884 5:38650512-38650534 AAATTTCCAGAGATGTGGAAAGG + Intergenic
989326109 5:40197194-40197216 AAATATTAACAGATCTGGGAAGG - Intergenic
989442232 5:41486423-41486445 AAAAATGGACTGTTGTGGGAGGG - Intronic
990166042 5:52994252-52994274 AAAAATCCAAACATGGGGAAAGG + Intronic
990462880 5:56046170-56046192 AAAAATCCATAGAAGTGAGAAGG - Intergenic
990685965 5:58301226-58301248 AAAAATACACAGATCTGGCCGGG - Intergenic
991617503 5:68512273-68512295 AACAATCTATAAATGTGGGAGGG - Intergenic
992783350 5:80147690-80147712 AAAAGTCAGCACATGTGGGAGGG - Intronic
993154120 5:84199969-84199991 AAAAACCCATAGACATGGGAAGG - Intronic
995174951 5:109165519-109165541 AACTATCCTCAGATGAGGGAAGG + Intronic
995662316 5:114499156-114499178 AAAAAGACACAGATATTGGAGGG + Intergenic
995740142 5:115347531-115347553 AAATATCCACAGGTGTGGAGGGG + Intergenic
995956489 5:117782964-117782986 ACAAATCCACAGAGCAGGGAAGG - Intergenic
995997520 5:118319719-118319741 AAAGATCCACAGAAGTGGCCAGG + Intergenic
996237698 5:121152560-121152582 AAAAAACAACAGATGTTGGTGGG - Intergenic
996882499 5:128315737-128315759 AAGAATCCACAAACCTGGGATGG + Intronic
996918846 5:128743623-128743645 AAAAATCCATAGAGTTGGGCTGG + Intronic
997359264 5:133284156-133284178 TTATCTCCACAGATGTGGGAGGG + Intronic
997486598 5:134236140-134236162 AAACATGCACAGAAGAGGGATGG + Intergenic
998064359 5:139145580-139145602 AAAAATCCACTTATCTGTGATGG - Intronic
999771589 5:154780137-154780159 AAAATTCCACAGCAGTGGGAGGG - Intronic
999977489 5:156926197-156926219 AAAAATCCACAGTAGTGGCCAGG - Intronic
1000004938 5:157174946-157174968 ACCCATCCACAGATGGGGGAGGG - Intronic
1000527093 5:162371087-162371109 AAATATCCACAGGTGTGGAGGGG + Intergenic
1000668153 5:164024675-164024697 AAAAAATAACAGATGTGGTAAGG - Intergenic
1000846419 5:166286842-166286864 AAAAATCCCCGAATGTGTGAAGG - Intergenic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1004286570 6:14326597-14326619 AAATATCAAGAGATCTGGGAAGG - Intergenic
1004347958 6:14865940-14865962 AAACGTCCACTGATGTGGGGGGG + Intergenic
1004805316 6:19197949-19197971 AAAAAATAACAGATGTGGCAAGG - Intergenic
1005615660 6:27570276-27570298 AAAAATACACGGATGTGTGGAGG + Intergenic
1005719286 6:28585330-28585352 AAAAATACACAAAGATGGGAGGG + Intronic
1005797360 6:29379916-29379938 AAGAATTCTCAAATGTGGGAAGG + Intronic
1007727665 6:43926386-43926408 AACACTCCACATAGGTGGGAAGG + Intergenic
1008805101 6:55417347-55417369 AAGAAGCCACAGCTGAGGGAGGG - Intergenic
1008927125 6:56898690-56898712 AAAAGCACAGAGATGTGGGAGGG - Intronic
1009393138 6:63166390-63166412 AAAAATCCAGGGATTTGGGCTGG - Intergenic
1011314488 6:86016506-86016528 AAAACACCACAGATATGGGCAGG + Intergenic
1011370525 6:86632653-86632675 AAAAAACCACAGATGCTGGCAGG - Intergenic
1012256206 6:97035687-97035709 AAAAATCCACTGATGTCTTATGG + Intronic
1012866064 6:104619076-104619098 ATAAATTCAAAGGTGTGGGAGGG - Intergenic
1013146868 6:107402851-107402873 CATAATCCCCAAATGTGGGAGGG - Intronic
1013162174 6:107555398-107555420 AAAAATACTCAGATTTGGCAAGG - Intronic
1015085440 6:129284898-129284920 AAAAGTTAACAGATGTGGAAAGG + Intronic
1015320989 6:131874532-131874554 AAAAAACAACAGATGTAGTAAGG + Intronic
1015453589 6:133399025-133399047 AAAAGTCCGCAGACATGGGAAGG - Intronic
1016018378 6:139210202-139210224 AAAAAAAAACAGATGTTGGAGGG + Intergenic
1016177258 6:141096224-141096246 AAATACCCACAGGTGTGGAAGGG - Intergenic
1016189291 6:141241917-141241939 ACAAATAAACAAATGTGGGATGG + Intergenic
1016501019 6:144720778-144720800 ATAAATACACAGAGGAGGGAGGG - Intronic
1017218680 6:151940275-151940297 CATAATCCCCACATGTGGGAGGG - Intronic
1017353296 6:153470977-153470999 AAAAACCCACAGATTTATGAAGG - Intergenic
1017596423 6:156033974-156033996 AAAAATCCACAGATCCAGGAAGG - Intergenic
1018159089 6:161020338-161020360 AAAAGTGCACACATGTGGGCAGG - Intronic
1018736469 6:166690230-166690252 ATAAATCCACTGCTCTGGGAGGG + Intronic
1018775172 6:167008258-167008280 AAAATTCCACAGCTGGGGAAGGG - Intronic
1020352022 7:7230981-7231003 AAAAATTCAGAGATGTAGGAAGG - Intronic
1020405065 7:7823881-7823903 AAAAATAAAGAGATGTGAGAAGG - Intronic
1020733588 7:11916501-11916523 AAAAATGCACAGATTGGGGCTGG + Intergenic
1022629687 7:32073095-32073117 AAAAAGTCATAGATGTGGTATGG - Intronic
1024022809 7:45387053-45387075 AAAAACCCAGAGCTGTGAGAGGG - Intergenic
1027193606 7:76012835-76012857 AAAAATACACAAAAGTGGGAAGG - Intronic
1028028259 7:85874648-85874670 AAAATTCCACAAAAGTGGAAAGG + Intergenic
1028830172 7:95319012-95319034 AAAAATGAACAGATGTGAGAAGG + Intronic
1030908822 7:115221017-115221039 AATAATCCACAGTTCTGGGCTGG - Intergenic
1031883920 7:127225949-127225971 AAAAATACATATATCTGGGAAGG + Intronic
1032895439 7:136245872-136245894 AAAAATCAAAAGATGTGGGTTGG + Intergenic
1033382350 7:140834675-140834697 AAAATCCCACAGATGTGGCACGG - Exonic
1033428207 7:141264479-141264501 AGAGAACCACAGATGAGGGAGGG + Intronic
1033793668 7:144822206-144822228 AAAAATCCAGAAATTGGGGAAGG - Intronic
1035550533 8:520453-520475 ATATATACACAGAAGTGGGATGG + Intronic
1035951034 8:4021356-4021378 AAAAATCCCCAGATGCGACACGG - Intronic
1037812151 8:22093234-22093256 AGAAATGCACAGCTGTGGGGAGG + Intronic
1037998536 8:23370601-23370623 AAGAATCCAGAGAGATGGGAAGG + Intronic
1038051053 8:23811881-23811903 ATTAATACACAGATGTTGGATGG + Intergenic
1038363125 8:26902756-26902778 AAAAATCCAGAGAAGTGGATGGG + Intergenic
1038952868 8:32434739-32434761 TAGAATCCCCAGATATGGGAGGG - Intronic
1039909070 8:41809980-41810002 GGGGATCCACAGATGTGGGAAGG + Intronic
1041341077 8:56846321-56846343 AAAAATGCCCAGCAGTGGGATGG - Intergenic
1041374469 8:57199618-57199640 AAACACCCACAGCTGTGGAAGGG - Intergenic
1041560284 8:59209741-59209763 AAAAAACAACAGATGTTGGCAGG - Intergenic
1041959545 8:63597140-63597162 ATAAACCCACAAATGTGAGAGGG + Intergenic
1043817854 8:84825338-84825360 TAAAAACCACAGATGTTGGCAGG + Intronic
1044762662 8:95537992-95538014 AAAAATTGAGAGATTTGGGAGGG - Intergenic
1044932629 8:97264636-97264658 CCAAATCCAAAGATGTTGGAGGG + Intergenic
1046939623 8:119918223-119918245 AAAAACCCACAGGTGTGGAGGGG + Intronic
1047872895 8:129104874-129104896 AAATATCCAGAGGTGAGGGAAGG + Intergenic
1048714035 8:137246997-137247019 AAAACTTTACAGATGTGGTAAGG + Intergenic
1049060736 8:140274225-140274247 AAAAACCCACAGAAAAGGGAAGG + Intronic
1049458622 8:142709473-142709495 AAACAGCCACAGGTGTGGCAGGG - Intergenic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052007360 9:23364084-23364106 AAAAATTTACTGAGGTGGGAAGG + Intergenic
1053126983 9:35589753-35589775 AAAAAATAACAGATGTGGGCTGG + Intergenic
1053377064 9:37616411-37616433 ATAAAACAACAGATGTGGGCCGG - Intronic
1053668848 9:40339671-40339693 AAAAACCCACAGGTGTGGAGGGG + Intergenic
1055888721 9:81099033-81099055 CATAATCCCCACATGTGGGAGGG + Intergenic
1056331222 9:85522823-85522845 AGTTATCCACAGATGCGGGAAGG - Intergenic
1056547494 9:87624897-87624919 AACCATCTTCAGATGTGGGAGGG + Intronic
1056826993 9:89883462-89883484 AAACACCCACAGATGTGGGAAGG + Intergenic
1057409841 9:94808378-94808400 AAAATGCCACAGATGTGAGGGGG + Intronic
1057917183 9:99065782-99065804 AAATATCCAGAGATGTGCAAGGG + Intronic
1058171226 9:101683486-101683508 GAAAATCCACAGATGTTTTATGG + Intronic
1058397801 9:104575176-104575198 AAAAAGCCACAGAGGTTGAAAGG + Intergenic
1059191040 9:112326579-112326601 AAAAACTCACATATATGGGAAGG - Intronic
1059658104 9:116374763-116374785 CAAAATCCAGAGATGTTGGAGGG - Intronic
1059916406 9:119107058-119107080 ATAAATCCACAATTGTGGTAGGG - Intergenic
1061564729 9:131430886-131430908 AAAAATCCACAGCTTTGGCCAGG - Intronic
1203443269 Un_GL000219v1:31180-31202 AAACACCCACAGGTGTGGAAGGG - Intergenic
1203456852 Un_GL000219v1:176141-176163 AAAAACCCACAGGTGTGGAGGGG + Intergenic
1203514077 Un_KI270741v1:150089-150111 AAACACCCACAGGTGTGGAAGGG - Intergenic
1186578615 X:10793152-10793174 TACTTTCCACAGATGTGGGAAGG - Intronic
1187268361 X:17757878-17757900 AAAAATACACATTTGTGGTAAGG - Intergenic
1189095031 X:38129463-38129485 AAAAATACTCAGAAGTGGAATGG - Intronic
1189708309 X:43781871-43781893 ATAAATCCAAAGATGTGTAAAGG + Intronic
1192213578 X:69142857-69142879 ACATATACACAGACGTGGGAGGG - Intergenic
1192295506 X:69843696-69843718 AAAAAGCCATATATATGGGATGG + Intronic
1192505819 X:71681927-71681949 AAATAGCAACAAATGTGGGATGG - Intergenic
1192796125 X:74425199-74425221 AAAAAGCCACAGAAGTTAGAAGG + Intronic
1194284610 X:91994652-91994674 GAAATTCCCCAGAAGTGGGATGG + Intronic
1195705332 X:107734184-107734206 AAAAACCCTCAGTTCTGGGAAGG - Intronic
1195714624 X:107806467-107806489 AAAATTGCTCAGCTGTGGGAAGG - Intergenic
1195885041 X:109629022-109629044 AAAAAACAACAGGTGTGGGGTGG + Intronic
1196783338 X:119401587-119401609 GCAAATGCACAGAGGTGGGAAGG + Intronic
1197367843 X:125587655-125587677 AAAAATACAGAGATGTGGGAGGG - Intergenic
1198132647 X:133713084-133713106 ACAAATCTACAGATTTGGGGTGG + Intronic
1198897107 X:141467701-141467723 AAAAATGCACAGGTGTGGTATGG + Intergenic
1199807145 X:151311576-151311598 AAAAATTCACAGATTAGAGAGGG - Intergenic
1200084065 X:153594345-153594367 GAAAACCCACAGGGGTGGGACGG + Intronic
1200602176 Y:5219220-5219242 GAAATTCCCCAGAAGTGGGATGG + Intronic
1200752391 Y:6958415-6958437 AAACACCCACAGATGTGGAGAGG - Intronic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202258262 Y:22942654-22942676 AAAAACCCACGGAGGTGGCATGG + Intergenic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202411252 Y:24576412-24576434 AAAAACCCACGGAGGTGGCATGG + Intergenic
1202459529 Y:25093660-25093682 AAAAACCCACGGAGGTGGCATGG - Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic