ID: 924133735

View in Genome Browser
Species Human (GRCh38)
Location 1:240940372-240940394
Sequence CTGTGGATCTGGAGACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 375}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924133735_924133745 29 Left 924133735 1:240940372-240940394 CCACCTGGTCTCCAGATCCACAG 0: 1
1: 0
2: 5
3: 44
4: 375
Right 924133745 1:240940424-240940446 TGACTTCCTTACACCTGTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 84
924133735_924133741 -9 Left 924133735 1:240940372-240940394 CCACCTGGTCTCCAGATCCACAG 0: 1
1: 0
2: 5
3: 44
4: 375
Right 924133741 1:240940386-240940408 GATCCACAGAAGAGCTTAGGGGG No data
924133735_924133740 -10 Left 924133735 1:240940372-240940394 CCACCTGGTCTCCAGATCCACAG 0: 1
1: 0
2: 5
3: 44
4: 375
Right 924133740 1:240940385-240940407 AGATCCACAGAAGAGCTTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 201
924133735_924133744 28 Left 924133735 1:240940372-240940394 CCACCTGGTCTCCAGATCCACAG 0: 1
1: 0
2: 5
3: 44
4: 375
Right 924133744 1:240940423-240940445 CTGACTTCCTTACACCTGTTAGG 0: 1
1: 0
2: 0
3: 13
4: 144
924133735_924133742 -8 Left 924133735 1:240940372-240940394 CCACCTGGTCTCCAGATCCACAG 0: 1
1: 0
2: 5
3: 44
4: 375
Right 924133742 1:240940387-240940409 ATCCACAGAAGAGCTTAGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924133735 Original CRISPR CTGTGGATCTGGAGACCAGG TGG (reversed) Intronic
901493056 1:9606353-9606375 CTTTGGTTCTGAAGTCCAGGTGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
905120630 1:35679246-35679268 CTGTGGAGAGGCAGACCAGGAGG - Intergenic
905303068 1:36998817-36998839 CAGTGGTTCTGGGGACCTGGAGG - Intronic
905385208 1:37598422-37598444 CTGAGGAACTGTAGACCTGGAGG - Intergenic
910253723 1:85225219-85225241 CCTTGGAGCTGGAGGCCAGGCGG - Intergenic
910568361 1:88671834-88671856 CTGTGGATTTGGATACGAGGGGG + Intergenic
910909442 1:92218030-92218052 CTGAGGACCTGGTGAGCAGGTGG + Exonic
911087607 1:93991932-93991954 CTGTGGATGAGGAGAACAAGTGG - Intergenic
912420896 1:109541704-109541726 TTGGGGATCTGGGGAGCAGGAGG + Intronic
912468241 1:109888755-109888777 CCATGGATCTGAAGATCAGGAGG + Intergenic
913689135 1:121261680-121261702 CCTTGGAGCTGGAGACCAGCTGG - Intronic
914148463 1:145018601-145018623 CCTTGGAGCTGGAGACCAGCTGG + Intronic
914751012 1:150534969-150534991 CTGGGGATCTGAACACCAGGAGG - Intergenic
915463869 1:156084623-156084645 CTGTGGTACTGGGGACCATGGGG + Intronic
916418783 1:164616976-164616998 CTCTGGATCTGGACTCCAGGTGG - Intronic
916457564 1:164986648-164986670 CTGTTAAACTGAAGACCAGGAGG + Intergenic
918041566 1:180916928-180916950 CTGGAGAGCTGGAGACCTGGAGG + Exonic
919879697 1:201893531-201893553 CTGTGGATGGGGAGAAAAGGAGG - Intergenic
920476458 1:206280155-206280177 CCTTGGAGCTGGAGACCAGCTGG - Intronic
922847344 1:228697591-228697613 CTCTGGATTTGGGGACAAGGAGG - Intergenic
923511253 1:234655733-234655755 CTGTGGAGCTGGAGGCCTTGGGG - Intergenic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
924905346 1:248446306-248446328 CTGAGTAACTGGAGCCCAGGGGG + Intergenic
1063957731 10:11282042-11282064 CAGTGGATATGGGGACCTGGGGG + Intronic
1064254424 10:13732039-13732061 CTGTGCTTCTGAAGGCCAGGAGG + Intronic
1064649603 10:17495678-17495700 CAGTGGATCTGGACATCCGGAGG + Intergenic
1067028684 10:42866043-42866065 CTGAGGATCAGGGAACCAGGAGG - Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071065357 10:81627170-81627192 CTGTTCATCTGGAGTCCAGTTGG - Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071514956 10:86291199-86291221 CTGTGGATCTGGAGGCCCTCTGG - Intronic
1072621767 10:97084350-97084372 TTGTGGCTCTGCAGCCCAGGTGG - Intronic
1074193090 10:111154997-111155019 CTCTGTATCTGGAGAGCCGGGGG + Intergenic
1074223920 10:111464732-111464754 CTGTGTAACTGGAGTGCAGGAGG + Intergenic
1076673360 10:132135202-132135224 CTGCGGAGCTGGGGACCTGGGGG + Intronic
1076696498 10:132249750-132249772 CAGTGGAACTGGAGACCCAGTGG + Intronic
1077443500 11:2579456-2579478 ATGTGGATCTGCATTCCAGGTGG + Intronic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1078551327 11:12282368-12282390 ATGGGGAGCTGGAGCCCAGGGGG - Intronic
1078956635 11:16204381-16204403 CTGAAGAACTGGAGACCTGGAGG + Intronic
1079747780 11:24155171-24155193 ATGTGGTTCTGTAGACCAGAGGG - Intergenic
1079929781 11:26543407-26543429 ATGTGGATCTGGAGACACAGAGG + Intronic
1080163900 11:29213652-29213674 CTTTGGATTTGGAGAACAGGAGG - Intergenic
1080317949 11:30971035-30971057 CTGGGGATGGGGATACCAGGTGG - Intronic
1082877316 11:58001433-58001455 CTGTGGTTCAGGAAAACAGGAGG - Intergenic
1083290990 11:61690032-61690054 CTGGGGCTCTGCAGACCCGGTGG - Intronic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1083785869 11:64946563-64946585 ATGTGCATCTGGAGAGCATGGGG + Intronic
1083859461 11:65412146-65412168 GTGTGGGTCTGGAGGCCAGGTGG - Exonic
1083991815 11:66250817-66250839 CAGTGCAGCTGGAGACCATGGGG + Intergenic
1084014144 11:66368858-66368880 CTGTGGGGCTGTTGACCAGGAGG + Intronic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1084518884 11:69650879-69650901 TTGTGGCTCCAGAGACCAGGTGG + Intronic
1085515061 11:77106972-77106994 CTGGGGAGCTGGAGGCCCGGGGG + Intronic
1086399616 11:86449863-86449885 CTGTCAGTCTGGAGACCTGGAGG - Intronic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1089090311 11:115869364-115869386 CTGGGGATGGGGATACCAGGTGG + Intergenic
1089748931 11:120636613-120636635 CGGTGGATCATGAGATCAGGAGG + Intronic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1090880890 11:130830650-130830672 CTGTGGATTTGGAGATCCTGGGG + Intergenic
1090911861 11:131128610-131128632 CTGGGGATGAGGATACCAGGTGG + Intergenic
1090950573 11:131469522-131469544 CTGCAGATCAGGAGACCTGGAGG + Intronic
1091704092 12:2681970-2681992 GTGAGGATCTGGAGCTCAGGAGG + Intronic
1096784499 12:54009305-54009327 CTTTGTATTTGGAGAACAGGGGG - Exonic
1098290490 12:68952901-68952923 AGGTGGATCTGGAGAACATGAGG + Intronic
1099087237 12:78260651-78260673 TGGTGGATCTGGAGCACAGGTGG - Intergenic
1099246925 12:80203165-80203187 TTATAGATCTGGATACCAGGAGG + Intergenic
1101142731 12:101812667-101812689 AGGAGGATCTTGAGACCAGGAGG + Intronic
1102819717 12:115897407-115897429 CCCTGAGTCTGGAGACCAGGTGG + Intergenic
1102955121 12:117054166-117054188 CCGAGGATCTGGGGAGCAGGGGG - Intronic
1104299318 12:127549805-127549827 CTGAGGATCACTAGACCAGGAGG - Intergenic
1106195442 13:27490398-27490420 TTCTGGATCTGGAGCCCAGGAGG - Intergenic
1106888887 13:34220982-34221004 ATGTGGATATTGACACCAGGTGG + Intergenic
1107982672 13:45748545-45748567 CTCTGGACCTTGTGACCAGGGGG + Intergenic
1109842458 13:67937270-67937292 CTCAGGAGCTGGAGACCAGCTGG + Intergenic
1110874054 13:80487977-80487999 ATATGGATCTGGAAACCAAGGGG + Intergenic
1111987680 13:95081261-95081283 ATGTGGATGTGGAGAAAAGGGGG - Intronic
1112120130 13:96400883-96400905 CTCTGAGTCTGGAAACCAGGAGG - Intronic
1113822948 13:113228230-113228252 CTGTGGACCTGAAGGCCAAGAGG - Intronic
1115646260 14:35370142-35370164 CTGTACATCTGGACACCTGGAGG - Intergenic
1116223357 14:42115343-42115365 CTGAGGCACTGGAGATCAGGTGG - Intergenic
1116800434 14:49437986-49438008 CTGTGGACCAGGAATCCAGGAGG - Intergenic
1119203453 14:72776497-72776519 CTGTGGAGATGGACTCCAGGGGG + Intronic
1121719905 14:96101930-96101952 CTGTGGATGGGAAGACAAGGGGG + Intergenic
1123943752 15:25229111-25229133 ATGTTGAACTGGAGACCTGGAGG + Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125391211 15:39195112-39195134 CTCTGGATCTGCAGACAAGCAGG - Intergenic
1126856203 15:52841784-52841806 CAGTGAATCTGGAGAGCAGCAGG + Intergenic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1128465540 15:67907796-67907818 TTGTGGATCTGAAGATGAGGGGG + Intergenic
1128559305 15:68654262-68654284 CTCTGGATTTGGAGTCCAGGGGG + Intronic
1129060106 15:72853937-72853959 ACGTGGATCTGGAGCTCAGGGGG - Intergenic
1129164644 15:73769650-73769672 CTGTGCATCTGCAGACCTGCCGG + Intergenic
1131466578 15:92660418-92660440 TTGTGGATCTTGTGACCAGGCGG - Intronic
1132749753 16:1452096-1452118 CTGTGCTGCTGGAGCCCAGGAGG - Intronic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1135063490 16:19290281-19290303 CTGTTGCTCTGGAAACCAGGAGG - Intronic
1135553550 16:23416938-23416960 CTGGGGAACTGGGGACCAGACGG - Intronic
1135850256 16:25957040-25957062 GGGTGGATCTGGAGACAAGGAGG + Intronic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1136278532 16:29193373-29193395 CTGTGGATCTCGTGTCCATGTGG + Intergenic
1136383930 16:29911174-29911196 CTGGGGACCAGGGGACCAGGAGG + Intronic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137761005 16:50940354-50940376 GTGTGGATCTGGCTTCCAGGAGG - Intergenic
1138531590 16:57637467-57637489 CTGTGGTTCAGGGGACCTGGGGG - Intronic
1139616143 16:68094138-68094160 TTGTGGATCTGGAGGTCAAGAGG + Intronic
1141964790 16:87434599-87434621 CGGTGGTGCAGGAGACCAGGCGG - Intronic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142082923 16:88159451-88159473 CTGTGGATCTCGTGTCCATGTGG + Intergenic
1142114938 16:88351652-88351674 CTGTGGATCTGAGGTCCAGACGG + Intergenic
1142324110 16:89402964-89402986 CTCTAGAGCTGGAGCCCAGGCGG - Intronic
1143165723 17:4896414-4896436 CTCTGGATCTGGGGAGAAGGAGG - Exonic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1147861971 17:43529105-43529127 CTGTGGGTCTAGGGACAAGGTGG - Intronic
1147909924 17:43849368-43849390 CTGGGGAGGTGGAGGCCAGGAGG - Intronic
1148587590 17:48791794-48791816 CTGGGGCTCTGGAGACTTGGAGG - Intronic
1148749336 17:49935588-49935610 CTGTGGAGCTGGACAGCCGGGGG + Intergenic
1150490082 17:65568377-65568399 TTGTGGATTTGCAGAGCAGGAGG - Intronic
1150646005 17:66977862-66977884 CTCTGGTTCTGGAGACCCTGGGG + Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1152534390 17:80942000-80942022 CTGTGCATCTGAAGAGCTGGCGG + Intronic
1152568632 17:81111550-81111572 GTGTGGATCTGCAGACCTGGAGG + Intronic
1152797528 17:82315549-82315571 CTGGGGCTCAGGAGACCTGGGGG - Intronic
1152891214 17:82882674-82882696 CTGTGAATCTGGAGAACAAGTGG + Intronic
1152988215 18:338537-338559 CTGTGGATGTGGAGACCCACTGG - Intronic
1155671790 18:28380253-28380275 CTGTGCTTTGGGAGACCAGGTGG + Intergenic
1156481253 18:37437729-37437751 CTCTGGCTGTGGAGATCAGGAGG - Intronic
1157112201 18:44832079-44832101 CTTTGGCTCTGGAGAACAGGTGG + Intronic
1157544147 18:48536209-48536231 CTGAGGATGTGGAAAACAGGAGG + Intergenic
1157891709 18:51424243-51424265 CTCTAGAGCTGGAGACAAGGTGG + Intergenic
1158309746 18:56145178-56145200 CTGTGGATCTGGGGTCAAGATGG - Intergenic
1160656683 19:275842-275864 CTTTGGATCTTGAGATCAGGAGG - Intergenic
1161220529 19:3116091-3116113 CAGTGGACCTGGAGCCCCGGAGG - Intronic
1162126748 19:8503566-8503588 CTGTGGCTCTCTAGCCCAGGAGG - Intergenic
1162195180 19:8979245-8979267 CTGTGGCTCTGGTGAGTAGGTGG + Exonic
1162736068 19:12747769-12747791 CTGTGACCCTGGAGAGCAGGGGG + Intronic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1166611571 19:44203539-44203561 GTCAGGAGCTGGAGACCAGGGGG - Intergenic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
925214889 2:2085856-2085878 CTGTGGATCAGGAAACCGAGTGG - Intronic
925876067 2:8312226-8312248 CTGTGAATGTAGAGAGCAGGAGG - Intergenic
926830639 2:16958507-16958529 CTGTGGGTCTGGAGCCATGGAGG - Intergenic
927464054 2:23323973-23323995 CTGGGTCCCTGGAGACCAGGGGG - Intergenic
932487578 2:72093896-72093918 ATTTGGATCTGGAGCTCAGGAGG - Intergenic
933254501 2:80065215-80065237 CTGTGGCTCTGGGGACCTGGGGG + Intronic
935282090 2:101527105-101527127 GTGTGGAGCTGGAGACAATGGGG + Intergenic
935365771 2:102289305-102289327 CTGTGGCTCTGGCCACCAGCTGG + Intergenic
935763669 2:106343735-106343757 CTCAGGATGTGGAGAGCAGGAGG - Intergenic
936483480 2:112906883-112906905 CTGGGCATGAGGAGACCAGGAGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936818183 2:116485214-116485236 CTGTGGATGGGGATGCCAGGTGG - Intergenic
936862463 2:117033652-117033674 CTTTGGAACTGGATAACAGGTGG - Intergenic
938824957 2:134995444-134995466 CAGTGGATCCAGAGAGCAGGTGG + Intronic
940476383 2:154168043-154168065 CTTCGGATCTGGAGTCCAAGTGG + Intronic
942228023 2:173833843-173833865 CTGAGGACCTTGAGACCAGCCGG - Intergenic
943435979 2:187866606-187866628 TTGTGGAGCTGGAGACCCAGGGG - Intergenic
946179191 2:217939819-217939841 CTGTGGAGCTGGAGCCCATGTGG - Intronic
946756431 2:222952314-222952336 GCTTGGAACTGGAGACCAGGTGG - Intergenic
947043505 2:225950231-225950253 CTGTGGATGGGGATGCCAGGTGG - Intergenic
947742787 2:232492502-232492524 CTTAGGATTTGGAGACCAGATGG - Intergenic
947866279 2:233400049-233400071 CTGTGCATCTGGAGTCCTGCAGG - Intronic
948188535 2:236040874-236040896 CTGTGTAGCTGGAGACCACATGG + Intronic
948518927 2:238523548-238523570 CTGCGCATCTGGAGGCCAGAAGG + Intergenic
948889389 2:240899569-240899591 TTGAGGACCTGGAGCCCAGGCGG - Intergenic
948963703 2:241359582-241359604 CAGGGGAACAGGAGACCAGGTGG - Intronic
949070342 2:242020713-242020735 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
949070635 2:242022153-242022175 CCGTGCAGCTGGAGACCCGGGGG + Intergenic
949070728 2:242022564-242022586 CCGTGCAGCTGGAGACCCGGGGG + Intergenic
949070739 2:242022610-242022632 CTGTGAAGCTGGAGACCCGGGGG + Intergenic
949070749 2:242022656-242022678 CTGTGAAGCTGGAGACCCTGGGG + Intergenic
949070795 2:242022871-242022893 CCGTGCAGCTGGAGACCTGGGGG + Intergenic
1169132232 20:3172373-3172395 CTCTGGTTCTGGGGACCAAGAGG - Intronic
1169371950 20:5034800-5034822 ATGCAGACCTGGAGACCAGGCGG - Intergenic
1169421842 20:5466676-5466698 CTTTGCATCTGGAGGCCAGCTGG - Intergenic
1171823613 20:29876186-29876208 CTCTGGAGCTGGAGAGCCGGGGG + Intergenic
1172973239 20:38888574-38888596 CCGTGGATGAGGAGTCCAGGGGG - Intronic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1173872759 20:46352083-46352105 TGGAGGTTCTGGAGACCAGGAGG + Exonic
1174472498 20:50771123-50771145 CTGTGTATCGGGGCACCAGGTGG - Intergenic
1174590427 20:51640580-51640602 CTGTGGAACTTTACACCAGGCGG - Intronic
1174858614 20:54069516-54069538 CTGTGGAACTGGAGTCCAGTCGG - Intronic
1174916448 20:54659069-54659091 ATGTGGATCAGGAGATGAGGGGG + Intergenic
1175500000 20:59442991-59443013 TTGTGGATCTGGAGCTGAGGGGG - Intergenic
1175693682 20:61085003-61085025 CTGTGGATCAGGGATCCAGGTGG - Intergenic
1175819553 20:61901267-61901289 CTGTGGCTCTTGTGACCAGAAGG - Intronic
1176231310 20:64034409-64034431 CTGTGGTTCTGGGGACCTTGAGG + Intronic
1180589128 22:16921329-16921351 CTCTGGGTCTGCAGAACAGGAGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1182566596 22:31204733-31204755 CTTTGGAACTCGAGACCAGTTGG + Exonic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1184444817 22:44540880-44540902 CTGTAGACCTGGGGCCCAGGTGG - Intergenic
1184697675 22:46149377-46149399 CAGGGGAACTGGAGATCAGGCGG - Intergenic
1185052146 22:48559551-48559573 TTGGGGACGTGGAGACCAGGGGG - Intronic
949158933 3:858142-858164 TTGTGGATCTGGAGTCCCAGGGG - Intergenic
949368809 3:3312205-3312227 CTGAGGAGCTGGAGACAATGTGG - Intergenic
949379948 3:3433392-3433414 CTGTGCATCTTGAGTGCAGGGGG - Intergenic
954299090 3:49689745-49689767 CTGTGGAGCTTGGGGCCAGGCGG + Intronic
954372543 3:50176400-50176422 CTGTGCCTCTGTAGCCCAGGGGG + Intronic
954462414 3:50634875-50634897 ATGTGGATATGGAGGCCATGGGG + Intronic
955429606 3:58828923-58828945 CTTAGGATTTGGAGACCAGCTGG + Intronic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956588698 3:70890459-70890481 CTGTGTTTATGGAGATCAGGTGG - Intergenic
956808044 3:72836530-72836552 CCCTGAATCTGGAGGCCAGGGGG - Intronic
956833166 3:73073276-73073298 CTGTGCATCTGTAGAAAAGGGGG + Intergenic
962343733 3:134605241-134605263 CTGTGGCCCTGGAAGCCAGGAGG - Intronic
962982654 3:140504778-140504800 CTCTGGCTCTGGAGAGAAGGTGG - Intronic
964623625 3:158738804-158738826 CTGGGCATGAGGAGACCAGGTGG + Intronic
967408009 3:189138765-189138787 CTTTGTGTCTGGAGAACAGGAGG + Intronic
967887872 3:194345628-194345650 CTGTGGGTCCCGAGACCAGCTGG + Intronic
968049797 3:195646840-195646862 CTGTGCAGCTGGAGATCCGGCGG + Intergenic
968049871 3:195647200-195647222 CCGTGCAGCTGGAGACCCGGTGG - Intergenic
968049892 3:195647294-195647316 CCGTGAAGCTGGAGACCCGGTGG - Intergenic
968049937 3:195647482-195647504 CCGTGCAGCTGGAGACCCGGCGG - Intergenic
968049992 3:195647749-195647771 CTGTGCAGCTGGAGACCCGCGGG + Intergenic
968050048 3:195648029-195648051 CCGTGCATCGGGAGACCCGGTGG + Intergenic
968050074 3:195648170-195648192 CTGTGCAGCTGGAGATCTGGTGG + Intergenic
968050154 3:195648549-195648571 CTGTGCAGCTGGAGACCCTGTGG + Intergenic
968050179 3:195648670-195648692 CCATGCATCTGGAGACCCGGTGG + Intergenic
968050229 3:195648905-195648927 CAGTGCAGCTGGAGACCCGGCGG + Intergenic
968097091 3:195939856-195939878 CAGTGCACCTGGAGACCCGGCGG - Intergenic
968097131 3:195940044-195940066 CCGTGCAGCTGGAGACCCGGTGG - Intergenic
968097157 3:195940185-195940207 CCGTGCATCTGGAGACCTGGTGG - Intergenic
968097166 3:195940231-195940253 CGGTGTAGCTGGAGACCCGGGGG - Intergenic
968097178 3:195940277-195940299 CCGTGGAGCTGGAGACCCGGCGG - Intergenic
968097218 3:195940465-195940487 CCGTGCAGCTGGAGACCTGGCGG - Intergenic
968097229 3:195940512-195940534 CCGTGCACCTGGAGACCCGGCGG - Intergenic
968097247 3:195940606-195940628 CCGTGCACCTGGAGACCTGGCGG - Intergenic
968097293 3:195940841-195940863 CTGTGCAGCTGGAGACCCGCGGG - Intergenic
968097322 3:195940983-195941005 CTGTGCAGCTGGAGACCCGGGGG - Intergenic
968097351 3:195941108-195941130 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
968097362 3:195941155-195941177 CCGTGCAGCTGGAGACCTGGTGG + Intergenic
968097383 3:195941249-195941271 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968097394 3:195941296-195941318 CCGTGCAGCTGGAGACCCGGCGG + Intergenic
968097428 3:195941437-195941459 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968097439 3:195941484-195941506 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968105599 3:195999354-195999376 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968105682 3:195999776-195999798 CCGTGAAGCTGGAGACCCGGGGG - Intergenic
968105704 3:195999871-195999893 CCGTGCATCTGGAGATCTGGTGG - Intergenic
968105810 3:196000355-196000377 CCGTGCAGCTGGAGACCTGGTGG - Intergenic
968105849 3:196000542-196000564 CCATGGAGCTGGAGACCCGGGGG - Intergenic
968105864 3:196000589-196000611 CTGTGCATCTGGAGACCCGGTGG - Intergenic
968105934 3:196000946-196000968 CTGTGCAGCTGGAGATCCGGCGG - Intergenic
968303877 3:197636936-197636958 CAGTGCAGCTGGAGACCCGGCGG - Intergenic
968303927 3:197637171-197637193 CCATGCATCTGGAGACCCGGTGG - Intergenic
968303953 3:197637292-197637314 CTGTGCAGCTGGAGACCCTGTGG - Intergenic
968304033 3:197637671-197637693 CCGTGCAGCTGGAGACCTGGTGG - Intergenic
968304083 3:197637953-197637975 CCATGCATCTGGAGACCCGGTGG - Intergenic
968304139 3:197638234-197638256 CTGTGCAGCTGGAGACCCGCGGG - Intergenic
968304205 3:197638548-197638570 CCGTGCAGCTGGAGACCCGGTGG + Intergenic
968304227 3:197638642-197638664 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968304238 3:197638689-197638711 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968304281 3:197638877-197638899 CCGTGAAGCTGGAGACCCGGTGG + Intergenic
968304337 3:197639142-197639164 CTGTGCAGCTGGAGATCCGGCGG - Intergenic
968428328 4:537574-537596 CTGTGGGGCTGGATACCAAGTGG + Intronic
968458301 4:710159-710181 CTGTGGGTTGGGAGACCAGGTGG + Intronic
969544895 4:7819536-7819558 CTTTAGATCAAGAGACCAGGGGG + Intronic
969631743 4:8343086-8343108 ATGTGGTTCTGAAGACCCGGAGG + Intergenic
969677221 4:8620816-8620838 CTGGAGCTCTGGAAACCAGGGGG - Intergenic
969678173 4:8626454-8626476 CTGGAGCTCTGGAAACCAGGGGG - Intergenic
969679129 4:8632092-8632114 CTGGAGCTCTGGAAACCAGGGGG - Intergenic
971024027 4:22570739-22570761 CTGGGGACTTGGACACCAGGTGG + Intergenic
971448105 4:26774075-26774097 TTATGGACCTGGGGACCAGGAGG - Intergenic
972206661 4:36781657-36781679 CTGTTGATCTGTAGGCCAGTAGG - Intergenic
972928067 4:44037198-44037220 CTATGGATCTGGAGATAATGGGG - Intergenic
973754226 4:54057450-54057472 CCCTGGATCTGGAGAACAGCAGG - Intronic
973890938 4:55366708-55366730 CTGAGGCTCTGGAGCCAAGGGGG - Intronic
974623014 4:64385139-64385161 TGGTGGCTCTGGTGACCAGGTGG + Intronic
975724844 4:77281883-77281905 CTGTAACTATGGAGACCAGGTGG + Intronic
978015589 4:103741464-103741486 CTGTAGATATGAAAACCAGGGGG - Intergenic
979558565 4:122077665-122077687 CTTTGGAACTCGAGACCAGTTGG - Intergenic
980126839 4:128782482-128782504 CTGTCAATCTGGTGACTAGGAGG + Intergenic
980493087 4:133555115-133555137 CTGTGGATGTTGAGAGCCGGAGG - Intergenic
981661969 4:147178128-147178150 CTCTGCATCTGGAACCCAGGAGG - Intergenic
981932898 4:150209589-150209611 CTGTGTAGCTGCACACCAGGGGG - Intronic
981975103 4:150717774-150717796 CAGTGGAACTGCAAACCAGGTGG - Intronic
982183732 4:152775356-152775378 CTGTAGATCTTAAGTCCAGGTGG + Intronic
982683576 4:158461131-158461153 TTGTGCATTTGGAGAGCAGGCGG + Intronic
983937297 4:173510810-173510832 TTGTGGATCTGGTGACAACGTGG - Intergenic
984439318 4:179746594-179746616 CTCTGGATCTAGAGACCACCAGG + Intergenic
985506507 5:284639-284661 CCGTGCAGCTGGAGACCGGGCGG + Intronic
985506594 5:285091-285113 CTGTGCAGCTGGAGACCTGGTGG - Intronic
985506627 5:285264-285286 CTGTGCAGCTGGAGACCCGGGGG + Intronic
985506676 5:285498-285520 CCGTGCAGCTGGAGACCTGGTGG + Intronic
985506756 5:285882-285904 CTGTGCAGCTGGAGACCCAGGGG + Intronic
985506762 5:285929-285951 CTGTGCAGCTTGAGACCCGGCGG + Intronic
985506807 5:286123-286145 CTGTGCAGCTGGAGACCCGGGGG + Intronic
985506834 5:286262-286284 CTGTGCAGCTGGAGACCCAGCGG + Intronic
985506888 5:286542-286564 CTGTGCAGCTGGAGACCCGTGGG + Intronic
985733935 5:1566383-1566405 GTGTGTGTCTGGAGGCCAGGTGG - Intergenic
985741038 5:1617657-1617679 CCGTGAAGCTGGAGACCCGGCGG - Intergenic
985741061 5:1617752-1617774 CCATGCATCTGGAGACCCGGTGG - Intergenic
985741071 5:1617799-1617821 CCGTGCATCTGGAGACCTGGTGG - Intergenic
985741114 5:1618033-1618055 CCGTGGAGCTGGAGACCCGGGGG - Intergenic
985741126 5:1618080-1618102 CCGTGAAGCTGGAGACCTGGCGG - Intergenic
985741148 5:1618175-1618197 CTGTGCATCTGGAGACCCAGTGG - Intergenic
985741214 5:1618487-1618509 CCGTGCATCTGGAGAACCGGTGG - Intergenic
985741233 5:1618575-1618597 CCGTGCATCTGGAGACCTGGCGG - Intergenic
985741276 5:1618764-1618786 CCGTGCATCTGGAGACCCGGTGG - Intergenic
985741299 5:1618859-1618881 CTGTGCATCTGGAGACCCGGTGG - Intergenic
985741314 5:1618952-1618974 CTGTGCAGCTGGAGACCTGACGG - Intergenic
985741341 5:1619094-1619116 CTGTGCATCTGGAGACCCGGTGG - Intergenic
985741432 5:1619501-1619523 CCGTGCATCTGGAGACCTGGTGG - Intergenic
985741454 5:1619595-1619617 CCGTGCACCTGGAGACCCGGCGG - Intergenic
985741490 5:1619783-1619805 CTGTGCAGCTGGAGACCCGCGGG - Intergenic
985741518 5:1619926-1619948 CTGTGCAGCTGGAGACCCGGGGG - Intergenic
985741555 5:1620098-1620120 CTGTGCAGCTGGATACCCGGTGG + Intergenic
985741565 5:1620145-1620167 CTGTGAAGCTGGAGACCCGGTGG + Intergenic
985741614 5:1620382-1620404 CTGTGCAGCTGGAGATCCGGTGG - Intergenic
986163704 5:5253733-5253755 CTGTGGATGTGGTGACCAGGTGG - Intronic
987366347 5:17152475-17152497 CAGTTGCTCTGGAGGCCAGGCGG - Intronic
988451447 5:31347691-31347713 CTGAGGAACTGCAGACCAGATGG - Intergenic
992963714 5:81980829-81980851 CAGTGGAGCTAGAAACCAGGAGG + Intronic
994776432 5:104040385-104040407 CTGTGAACCTTGAGACCAGAGGG - Intergenic
996382728 5:122878271-122878293 GTGTGGTTCTGGAGACCCAGTGG + Intronic
997513608 5:134469332-134469354 CTATGGATCTGAAAGCCAGGAGG - Intergenic
997578004 5:134997555-134997577 CACTGGATTTGGAGACAAGGAGG - Intronic
999083350 5:148864938-148864960 CTGGGGATCTGGTGCCCTGGAGG + Intergenic
999502525 5:152161076-152161098 CTGAGGTTCAGGAAACCAGGAGG + Intergenic
999858581 5:155621129-155621151 CTGCGGGGCTGGAGACCAAGGGG - Intergenic
999922818 5:156341182-156341204 CTGTGGAAGTCAAGACCAGGAGG - Intronic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000267527 5:159652066-159652088 CTGTGGATATGCAGAACTGGGGG - Intergenic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002644207 5:180645274-180645296 CCGTGGGGGTGGAGACCAGGAGG + Intronic
1003146334 6:3513408-3513430 CTGTGTACCTGCAGCCCAGGTGG - Intergenic
1003168679 6:3703312-3703334 TTGTGGATGTGGGGGCCAGGTGG - Intergenic
1003541249 6:7019939-7019961 ATGAAGATCTGGAGACCAGCTGG - Intergenic
1004310772 6:14543000-14543022 CTGGGTATGTGGTGACCAGGGGG + Intergenic
1004321302 6:14633668-14633690 CAGGGAGTCTGGAGACCAGGAGG - Intergenic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1005416277 6:25603668-25603690 CTGTGGACCAGTAGACCAGCAGG - Intronic
1006786900 6:36674254-36674276 CTATGGAACTGGGGATCAGGAGG + Intergenic
1006836546 6:37002487-37002509 GTGTGAATCAGGAGACCAGAAGG + Intergenic
1010452568 6:76019226-76019248 CTGTTGGTCTGGAAACCAGCAGG + Intronic
1011391517 6:86858978-86859000 CTGTGCTTCTGAAGACCATGAGG - Intergenic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1016994907 6:149954718-149954740 CTGTGGACCCGGAGGCCCGGGGG + Intergenic
1017003702 6:150014718-150014740 CTGTGGACCCGGAGGCCCGGGGG - Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1019164632 6:170089871-170089893 GTGTGAATCTGGAGCACAGGTGG - Intergenic
1019739190 7:2664350-2664372 CTGGGGTTCTGGGGTCCAGGGGG - Exonic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022293290 7:29023641-29023663 CTATGGATTGGGACACCAGGTGG - Intronic
1022469404 7:30673043-30673065 CTGAGGATCTGGACACCAAGTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022812297 7:33881819-33881841 CTTTGGAGCTGGAGACAATGTGG - Intergenic
1024579045 7:50787252-50787274 ATGGGGCTCTGGAGAGCAGGAGG + Intronic
1024715433 7:52074645-52074667 CTGTGGCACAGGAGACCAGAAGG + Intergenic
1024753643 7:52501886-52501908 CTGTGCATCTGGTGAGCACGTGG + Intergenic
1024991004 7:55234495-55234517 CTGTGGAGCAGAACACCAGGGGG + Intronic
1025233517 7:57218578-57218600 TTGTGGAGCTGGAGACCTGGGGG + Intergenic
1025722529 7:64029358-64029380 ATGTGGATCTGGTTTCCAGGTGG - Intergenic
1025744045 7:64227248-64227270 ATGTGGATCTGGTTTCCAGGTGG - Intronic
1025751266 7:64295666-64295688 ATGTGGATCTGGTTTCCAGGTGG - Intergenic
1026817818 7:73525887-73525909 CTGAGGATCTTGAGTCCAGGAGG - Intergenic
1027953985 7:84856626-84856648 CTGTGGATATGGTCTCCAGGTGG - Intergenic
1029492669 7:100880798-100880820 ATGTGGGTCTGGAGCACAGGCGG + Intronic
1029885862 7:103870874-103870896 CTGTGGAGCTAGGCACCAGGAGG - Intronic
1031779644 7:125945264-125945286 TGGTGGATCTGTAGATCAGGTGG + Intergenic
1032501739 7:132404831-132404853 CTGTGGCCCAGGAGACCAGAAGG + Intronic
1032529106 7:132605435-132605457 CTTTGGTCCTGGAGAACAGGTGG + Intronic
1034338473 7:150338184-150338206 CTCTGGCTCTGGAGCACAGGAGG + Intergenic
1035229926 7:157458763-157458785 CTGTGGACCTGCTGACCATGTGG + Intergenic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1036608328 8:10328107-10328129 ATGGGGATCTGGAGTCCAGAGGG - Intronic
1037607991 8:20453633-20453655 CTGTGGATCAGGAGCACTGGCGG - Intergenic
1037686279 8:21142188-21142210 CTGTCTATTTGGAGAGCAGGTGG - Intergenic
1037822014 8:22139636-22139658 TTGTGGCTCTGGGCACCAGGTGG - Intronic
1037961158 8:23099323-23099345 CAGTGGATCTGGGGATGAGGAGG - Intronic
1037970521 8:23168534-23168556 CAGTGGATCTGGGGATGAGGGGG + Intergenic
1038193406 8:25344415-25344437 CTGGAGATCTGAAGACCAGCAGG + Intronic
1038397600 8:27258605-27258627 CTGTGGAGCTGGAGAACCAGAGG + Intergenic
1038939594 8:32289329-32289351 CTGAGGAGCTGGAGAACAAGAGG - Intronic
1040569269 8:48593198-48593220 ATGTGGATCTGGTGTCCAGGGGG + Intergenic
1042321824 8:67483733-67483755 CTTTGGATCTGGATCCCAGTTGG + Intronic
1042482932 8:69324088-69324110 TTGTGGAGCTGGAGACCCAGGGG + Intergenic
1047310048 8:123684369-123684391 CTGTGGCTCTGGAGAGCTAGTGG - Intronic
1047819103 8:128499032-128499054 ATGAGGATCTGGAGACCAAAAGG + Intergenic
1048163121 8:132038940-132038962 CTGAGGATCTGGACAGCAGCTGG - Intronic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049369104 8:142255014-142255036 TTGAGGATCTTGAGGCCAGGTGG + Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1050970142 9:11860209-11860231 GTGTGGAACTGGATCCCAGGAGG + Intergenic
1051019551 9:12525737-12525759 TTATAGATCTGGTGACCAGGAGG - Intergenic
1051911294 9:22155406-22155428 GTGTGGCCCTGGAGACCACGAGG + Intergenic
1053173209 9:35905419-35905441 CTGTTGAACTGGGAACCAGGAGG + Intergenic
1054191818 9:61990045-61990067 CTGTGCAGCTGGATACCACGTGG - Intergenic
1054461493 9:65467571-65467593 CTGTGCAGCTGGATACCACGTGG + Intergenic
1054646552 9:67597667-67597689 CTGTGCAGCTGGATACCACGTGG + Intergenic
1055082785 9:72283503-72283525 CTGTGGATCGGGAATCCAAGGGG + Intergenic
1056022043 9:82448138-82448160 CTGAAGAACTGAAGACCAGGTGG + Intergenic
1056067978 9:82956684-82956706 GTGGGGATCTGGAGAGGAGGTGG + Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056631352 9:88295649-88295671 CTGTGGATCTGGGGAAGAGGGGG - Intergenic
1057307603 9:93921213-93921235 CTGGGGAACTGGAGAGCTGGGGG + Intergenic
1057911495 9:99023407-99023429 CTCTGGCTCTGGTGACCTGGTGG + Exonic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1057939281 9:99266754-99266776 CTGTGGTTTTGCAGACCAGCGGG - Intergenic
1058108704 9:101004920-101004942 CTGTGGATCTAGCTACTAGGTGG - Intergenic
1060407633 9:123380796-123380818 GGGAGGATCTGGGGACCAGGGGG - Exonic
1060848290 9:126854636-126854658 GTGGGGATCTGGAGAGTAGGAGG - Intergenic
1061391644 9:130320279-130320301 CTGGGGAGCTGGAGCCCATGGGG + Intronic
1062415641 9:136448260-136448282 CTGTGGATCTGGCGACTCTGGGG - Intronic
1187326601 X:18295765-18295787 CTGTGGATGAGGACGCCAGGTGG - Intronic
1191846233 X:65550083-65550105 GTGTAGATCTGGAGGCCAGGTGG + Intergenic
1192539048 X:71952825-71952847 ATGTGGATCTGGTCCCCAGGTGG - Intergenic
1193425739 X:81338435-81338457 GTGTTGATCTGGAGGCCTGGGGG + Intergenic
1196035363 X:111138099-111138121 CTTTGGTTCTGGAGACAAAGTGG + Intronic
1196789386 X:119450303-119450325 CACTGGATTTGGAAACCAGGAGG + Intronic
1198284217 X:135173805-135173827 CACTGGATTTGGAGACCTGGAGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199381836 X:147180829-147180851 ATCTGGATCTGGAGAAGAGGTGG + Intergenic
1200232023 X:154448854-154448876 CAGTGGGGCTGGAGACCAAGAGG + Intronic
1200954024 Y:8927498-8927520 CTGTGGATCTGCAATCTAGGTGG + Intergenic
1200986475 Y:9306764-9306786 CTGTGGATCTGCAATCTAGGTGG - Intergenic
1202107476 Y:21385754-21385776 CTGTGGATCTGCAATCTAGGTGG - Intronic
1202124104 Y:21554138-21554160 CTGTGGATCTGCAATCTAGGTGG + Intergenic
1202154904 Y:21875242-21875264 CTGTGGATCTGCAATCTAGGTGG - Intergenic
1202195883 Y:22297966-22297988 CTGTGGATCTGCAATCTAGGTGG - Intergenic
1202199467 Y:22331341-22331363 CTGTGGATCTGCAATCTAGGTGG + Intronic