ID: 924136959

View in Genome Browser
Species Human (GRCh38)
Location 1:240977790-240977812
Sequence GTACCAAAAACAGCTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924136956_924136959 1 Left 924136956 1:240977766-240977788 CCCATTCACTGTAGTACATCAAC 0: 1
1: 0
2: 1
3: 2
4: 94
Right 924136959 1:240977790-240977812 GTACCAAAAACAGCTGCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 131
924136957_924136959 0 Left 924136957 1:240977767-240977789 CCATTCACTGTAGTACATCAACA 0: 1
1: 1
2: 0
3: 14
4: 147
Right 924136959 1:240977790-240977812 GTACCAAAAACAGCTGCAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924136959 Original CRISPR GTACCAAAAACAGCTGCAGT GGG Intronic