ID: 924136959 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:240977790-240977812 |
| Sequence | GTACCAAAAACAGCTGCAGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 141 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 131} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924136956_924136959 | 1 | Left | 924136956 | 1:240977766-240977788 | CCCATTCACTGTAGTACATCAAC | 0: 1 1: 0 2: 1 3: 2 4: 94 |
||
| Right | 924136959 | 1:240977790-240977812 | GTACCAAAAACAGCTGCAGTGGG | 0: 1 1: 0 2: 0 3: 9 4: 131 |
||||
| 924136957_924136959 | 0 | Left | 924136957 | 1:240977767-240977789 | CCATTCACTGTAGTACATCAACA | 0: 1 1: 1 2: 0 3: 14 4: 147 |
||
| Right | 924136959 | 1:240977790-240977812 | GTACCAAAAACAGCTGCAGTGGG | 0: 1 1: 0 2: 0 3: 9 4: 131 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924136959 | Original CRISPR | GTACCAAAAACAGCTGCAGT GGG | Intronic | ||