ID: 924138017

View in Genome Browser
Species Human (GRCh38)
Location 1:240991399-240991421
Sequence GCCCTCTACTGGAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924138013_924138017 -6 Left 924138013 1:240991382-240991404 CCTCAGGATTATTTCCTGCCCTC 0: 1
1: 0
2: 2
3: 21
4: 228
Right 924138017 1:240991399-240991421 GCCCTCTACTGGAGCTCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 143
924138012_924138017 -5 Left 924138012 1:240991381-240991403 CCCTCAGGATTATTTCCTGCCCT 0: 1
1: 0
2: 0
3: 19
4: 230
Right 924138017 1:240991399-240991421 GCCCTCTACTGGAGCTCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 143
924138011_924138017 -2 Left 924138011 1:240991378-240991400 CCACCCTCAGGATTATTTCCTGC 0: 1
1: 0
2: 0
3: 19
4: 171
Right 924138017 1:240991399-240991421 GCCCTCTACTGGAGCTCAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924138017 Original CRISPR GCCCTCTACTGGAGCTCAGG AGG Intronic
900777944 1:4598852-4598874 CCCCTGCCCTGGAGCTCAGGTGG - Intergenic
902043573 1:13509622-13509644 CCCCTCTGCTGGAATTCAGGGGG - Intronic
903400941 1:23047805-23047827 CCCAGCTACTTGAGCTCAGGAGG + Intronic
906951295 1:50336201-50336223 GCCCTTTCCTGGGGGTCAGGAGG + Intergenic
907327810 1:53652334-53652356 GCCTTCTATGGGAGCTCAGTGGG + Intronic
912182979 1:107240453-107240475 GCCCTCTACTACACCACAGGTGG - Intronic
915683517 1:157606343-157606365 GTCCTGTACTGGATCCCAGGGGG + Intergenic
920244249 1:204576111-204576133 TCCCTGTACAGGAGGTCAGGAGG - Intergenic
924138017 1:240991399-240991421 GCCCTCTACTGGAGCTCAGGAGG + Intronic
1065897446 10:30176630-30176652 CCTCTCACCTGGAGCTCAGGTGG - Intergenic
1066258498 10:33705248-33705270 GGCCTGGACTGAAGCTCAGGTGG + Intergenic
1070590304 10:77796227-77796249 TCCCTCTGCTGGGGCTCAGCAGG - Intronic
1071261841 10:83927107-83927129 GTCCACTACTGGGGATCAGGAGG + Intergenic
1074368947 10:112883259-112883281 ACCCTTTACTTGAGCTCAGGTGG - Intergenic
1074372285 10:112909763-112909785 GCCCTAGACTGGACATCAGGGGG + Intergenic
1075341306 10:121648657-121648679 GCCCTCCACAGGAGCCCAGCTGG + Intergenic
1075823593 10:125334715-125334737 GCCTGCTACTGGAGCTCTGGAGG + Intergenic
1075967877 10:126628516-126628538 GCCCTCTGCTTGAGGTCTGGTGG + Intronic
1076661774 10:132060132-132060154 GCCCTCTCTTGGTGCTGAGGTGG - Intergenic
1077993633 11:7434015-7434037 GCCCTGTGCTGTAGCTGAGGTGG - Intronic
1079540633 11:21569821-21569843 GACCTCAACTGTAGGTCAGGAGG + Intronic
1081702943 11:45163426-45163448 GCCCTCCTCTGCTGCTCAGGTGG + Intronic
1081713570 11:45233381-45233403 CACCTCAGCTGGAGCTCAGGGGG - Intronic
1085036116 11:73301097-73301119 ACTCTCTACAGGGGCTCAGGTGG - Intergenic
1085795738 11:79537861-79537883 GCCCTGCACTGAAGGTCAGGTGG + Intergenic
1088584810 11:111353129-111353151 GCCCTCTGCTGGTGCTGTGGAGG - Exonic
1088927576 11:114317916-114317938 ACCCTCTGCTGGCGCTCAGAGGG - Intergenic
1089120674 11:116132476-116132498 GCCCTATATTGGAGCTCCAGTGG + Intergenic
1089278608 11:117356557-117356579 GCCCTCTGCTGGAGCTCTGCTGG - Intronic
1090934576 11:131330082-131330104 CCCTTCTCCTGGAGCTCAGTAGG + Intergenic
1094525949 12:31231128-31231150 GCCCTCTACTCCAGCACTGGTGG - Intergenic
1096460597 12:51819829-51819851 GCCCTTTGCAGGAGCTCTGGAGG - Intergenic
1101497931 12:105273254-105273276 GTTCTCTCCCGGAGCTCAGGTGG + Intronic
1103996363 12:124832974-124832996 GCTTCCTTCTGGAGCTCAGGGGG + Intronic
1104058002 12:125245273-125245295 GCCCCCCACTGCAGTTCAGGAGG + Intronic
1104105815 12:125657906-125657928 GCCCTCTACTGCAGCACATCTGG - Exonic
1106554476 13:30798064-30798086 GACCACTCCTGGAGCCCAGGAGG + Intergenic
1107080847 13:36373284-36373306 GCCCAGTACCTGAGCTCAGGAGG - Intergenic
1107291916 13:38864282-38864304 GCTCTCTAGTGGAGATCACGGGG - Exonic
1108121522 13:47193156-47193178 GCCCTCTTCTGGGGCACAGCAGG + Intergenic
1111864539 13:93752313-93752335 GCCATCTTCAGGAGCTCAGCAGG + Intronic
1111868836 13:93804657-93804679 CCCCTCTACTGGAGTTTGGGAGG - Intronic
1113809080 13:113126730-113126752 GACCCCAACTGGAGCCCAGGAGG + Intronic
1113816592 13:113175924-113175946 GCTCTCACCTGGAGCTCAGCAGG - Intergenic
1118878696 14:69808080-69808102 GCCTGCCACTGGGGCTCAGGTGG + Intergenic
1119652464 14:76393290-76393312 GGCGTCTACTGGAGCTACGGAGG - Intronic
1121362796 14:93277391-93277413 GCCCTCTACTGTAATGCAGGGGG + Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1123141757 14:106086797-106086819 CCCTTTTCCTGGAGCTCAGGTGG - Intergenic
1123151550 14:106186256-106186278 GCCCTTTCCTGGAGCTCAAGAGG + Intergenic
1123171696 14:106378622-106378644 GCCCTTTCCTGGAGCTCAAGAGG + Intergenic
1123193151 14:106590975-106590997 GCCCTTTCCTGACGCTCAGGTGG - Intergenic
1123399944 15:19974141-19974163 GACCTTTCCTGGAGCTCAAGAGG + Intergenic
1123959140 15:25376420-25376442 GCCGACTACTTGAGCCCAGGAGG + Intronic
1124707135 15:31975483-31975505 GCCAGCCACTGGGGCTCAGGGGG - Intergenic
1130906371 15:88243352-88243374 GCTCCCTCCTGGATCTCAGGTGG + Intronic
1131310059 15:91282485-91282507 GCCCCCTAATGAAGCTCAGTTGG - Intronic
1132359685 15:101201933-101201955 GCCCACTACAGCAGCTAAGGAGG + Intronic
1133236294 16:4388825-4388847 GCCCTCAACTGGGGCGGAGGCGG - Intronic
1136083393 16:27867699-27867721 GCCCTCTACTGGCCACCAGGAGG + Intronic
1136870626 16:33804333-33804355 GCCCTTTCCTGGCGCTCAGGTGG + Intergenic
1137629118 16:49929835-49929857 TCCCTCTCCTGGACCTGAGGAGG - Intergenic
1137894030 16:52191714-52191736 GCCCTCTAGTGGTGCTGCGGGGG - Intergenic
1203101546 16_KI270728v1_random:1311725-1311747 GCCCTTTCCTGGCGCTCAGGTGG - Intergenic
1143725152 17:8839509-8839531 GCCCCGGCCTGGAGCTCAGGGGG - Intronic
1144383517 17:14726929-14726951 GTCCTCCACTGGAGCTCAATGGG - Intergenic
1148551097 17:48551174-48551196 GCCCTCTGCTGGATCCGAGGGGG + Exonic
1151226629 17:72652975-72652997 GACATTTACTGGGGCTCAGGGGG - Intronic
1153403273 18:4705250-4705272 GCTCTCTCCTGGAGCAGAGGGGG + Intergenic
1153403481 18:4707535-4707557 GCTCTCTCCTGGAGCAGAGGGGG + Intergenic
1160696009 19:484856-484878 GGCCTCTGCTGGAGCAGAGGAGG + Intergenic
1165313803 19:35042801-35042823 GTCCTCTGCTGGGGCTGAGGCGG + Intronic
1165390385 19:35535201-35535223 GCCCTCCTCTGTAGCTCAGGCGG + Intronic
1166074088 19:40403851-40403873 GCCCTCTGCAGGAGCTGAGGCGG - Exonic
926174316 2:10575725-10575747 GGCCTCTGCAGGAGCTGAGGTGG + Intronic
928102228 2:28445779-28445801 GCACTCACCTGGAGCTCAGAAGG + Intergenic
933788905 2:85867965-85867987 TCCCTCTACTTCAGCTCAGCAGG + Intronic
936826935 2:116593230-116593252 GCCCTCTACCGCAGCTCCCGGGG - Intergenic
936884524 2:117294214-117294236 GCCTTATATGGGAGCTCAGGTGG + Intergenic
937144611 2:119632558-119632580 GCCCTATACTTGATCTTAGGAGG - Intronic
937302584 2:120852320-120852342 GCCCGAAAATGGAGCTCAGGAGG - Intronic
938677692 2:133655507-133655529 GACCTGTACTGGATCTCAGTGGG - Intergenic
939519986 2:143217833-143217855 GCCCTCCACTAGAGCTGAGTAGG + Intronic
940848030 2:158661961-158661983 GCCCTGTACTCGGGCACAGGAGG - Intronic
943561885 2:189473599-189473621 GCCCTCTGCTGGGGCTGAGGAGG + Intronic
945241622 2:207681686-207681708 GCCCTCTCCTGCGGCCCAGGGGG - Intergenic
948145752 2:235707229-235707251 CCCATCTGCAGGAGCTCAGGAGG - Intronic
1168810508 20:701633-701655 ACCTGCTACTGGAGGTCAGGAGG - Intergenic
1172778826 20:37423710-37423732 CCCCTCTCCTGGCGCACAGGAGG + Intergenic
1173243318 20:41317230-41317252 GCCCGCTCCTGGAGCCCGGGGGG + Intronic
1175353866 20:58346479-58346501 TCCCTCCACTGGAGCCCAGCTGG + Intronic
1177532210 21:22374721-22374743 GCTCTCTACTGGGGCGCGGGAGG + Intergenic
1177892003 21:26816180-26816202 GACCTCTAGTGGAGCTAAGTGGG - Intergenic
1179545003 21:42107865-42107887 GCCCTCTCCTGGAGCAATGGGGG - Intronic
1180108665 21:45637396-45637418 GCTCTCTCCTGGAGCTCAGCAGG - Intergenic
1181682474 22:24505365-24505387 ACCCTATAATGGAGCTCAGTGGG - Intronic
1183206431 22:36422648-36422670 GGGCTCGACTCGAGCTCAGGAGG + Intergenic
1183320785 22:37163927-37163949 GCCCCAAAGTGGAGCTCAGGTGG + Intronic
1183420175 22:37707295-37707317 GCCATCTTCTGGGGCCCAGGAGG - Intronic
949587420 3:5455380-5455402 GCCCTATACTGGAGCCAAGATGG + Intergenic
952362723 3:32646921-32646943 GCTCTCTAAAGCAGCTCAGGAGG + Intergenic
952812962 3:37421671-37421693 TCCCTATACTGAAGCTCACGTGG - Intronic
953319148 3:41956356-41956378 GCCCTCCAGTGCTGCTCAGGTGG + Intronic
954712590 3:52512486-52512508 GCCCTCTCCAGCACCTCAGGTGG + Intronic
967096245 3:186179823-186179845 CACCTGTACTGGAGCTCAGGAGG - Intronic
969156859 4:5218902-5218924 GGCCCCTACTGGGCCTCAGGTGG + Intronic
969169486 4:5348498-5348520 CCCCTCTACTAGAGGTCGGGTGG - Intronic
969584452 4:8083958-8083980 AGCCTCAGCTGGAGCTCAGGGGG + Intronic
972740630 4:41882950-41882972 GCCCTCTGCTGGAGCGCGCGGGG + Intergenic
979365254 4:119814696-119814718 TCCCTTTCCTGGAGGTCAGGGGG - Intergenic
981580059 4:146242117-146242139 GCCCTCTAGTGGAAATCTGGAGG - Intergenic
983543402 4:168936167-168936189 GCCCTCTACTGCAGGTCTGCTGG - Intronic
990529163 5:56656769-56656791 ACCCACTCCTGGAGCTCAGGAGG + Intergenic
1001279233 5:170374512-170374534 CCCCAGTTCTGGAGCTCAGGTGG + Intronic
1001339768 5:170832400-170832422 GCCCTCCTCTGGAGCCCAGTGGG - Intergenic
1001896887 5:175390060-175390082 GCCCTGTCCTAGAGCTCATGTGG - Intergenic
1002371320 5:178757349-178757371 GCCCTCCTCTGGAGCCCAGTGGG + Intergenic
1002536920 5:179880915-179880937 TCCCTCTGGGGGAGCTCAGGTGG - Intronic
1002601631 5:180357049-180357071 GCCCTCTGCTGAAGTTCAGGAGG - Intergenic
1005631528 6:27712567-27712589 TCCCTCTTCTGGTGTTCAGGTGG - Intergenic
1005636466 6:27757720-27757742 GCTCTCTGCTGGAACTCATGTGG + Intergenic
1006466160 6:34196164-34196186 GGACCCTCCTGGAGCTCAGGAGG - Intergenic
1006822986 6:36913324-36913346 GCCCTCTATCCCAGCTCAGGAGG - Intronic
1006829799 6:36961868-36961890 TCCCCCTACAGGAGGTCAGGAGG - Exonic
1007402445 6:41611168-41611190 TCCCTCTACTGTAGCTCAGTAGG - Intergenic
1007547952 6:42708498-42708520 CCCCTCTACTGGCCCTCTGGAGG + Intronic
1016648538 6:146437894-146437916 GCGTTCTAGTGGAGCTCTGGGGG + Intergenic
1016709821 6:147156745-147156767 GCTCTCTACTGGGACTAAGGAGG + Intergenic
1017278037 6:152592952-152592974 GCCCACCCCAGGAGCTCAGGTGG - Intronic
1019721336 7:2573885-2573907 GCCCTCTACAGAAGCTCTGTGGG + Intronic
1021957799 7:25843653-25843675 GCCCTCTGCTGGAGCTGCCGAGG - Intergenic
1022280184 7:28900445-28900467 GCTCTGAACTGGAGCTCAGCAGG - Intergenic
1023183975 7:37514468-37514490 GCCCTCTATGGGAGCTCCAGAGG + Intergenic
1023943754 7:44787123-44787145 GCCTTCCACTTGAGCTCAGAAGG - Intergenic
1024253180 7:47521497-47521519 GCCCTCAGCTGGAGCCCAGGAGG - Intronic
1024664803 7:51536015-51536037 GCCCTCTTCTGCAGGTCAGCTGG + Intergenic
1024988247 7:55214143-55214165 GCCCTTTGCTTGAGCTCAGAAGG - Intronic
1026799663 7:73391697-73391719 TCCATCTATTTGAGCTCAGGGGG + Intergenic
1030060694 7:105618643-105618665 TGCCTCTACTGGACCTCAGTGGG + Intronic
1030299020 7:107956722-107956744 TCCCAGTACTGGAGCTGAGGGGG + Intronic
1032435792 7:131899380-131899402 GGCCTCAACTGGAGCACATGAGG - Intergenic
1033009244 7:137602220-137602242 GCACTCTACTATAGCACAGGTGG - Intronic
1033246085 7:139717357-139717379 GCTTTCTACTGAAACTCAGGAGG + Intronic
1033813559 7:145046123-145046145 GCACTGCCCTGGAGCTCAGGTGG + Intergenic
1036652663 8:10655113-10655135 ACCATCTGTTGGAGCTCAGGAGG - Intronic
1037885661 8:22594834-22594856 GAGCCCTCCTGGAGCTCAGGAGG + Intronic
1040109918 8:43562696-43562718 GCCCTGTGCTGGACCTGAGGGGG - Intergenic
1043707752 8:83374387-83374409 GCACACTGCTTGAGCTCAGGAGG - Intergenic
1050053965 9:1632546-1632568 GCTCTTTACTTTAGCTCAGGAGG + Intergenic
1053062498 9:35043254-35043276 GCCATCTTCCTGAGCTCAGGTGG + Exonic
1053281275 9:36821015-36821037 GCCCTGCTCTGCAGCTCAGGAGG - Intergenic
1054718941 9:68584578-68584600 GCCCTCTTGTGGAGGGCAGGAGG - Intergenic
1061002833 9:127912115-127912137 GCCCTCTAATGGGGGGCAGGAGG - Intronic
1061084573 9:128391605-128391627 GGCCGCTCCTGCAGCTCAGGGGG - Exonic
1062206632 9:135341235-135341257 GCCCTCTGCCGCAGCTCAGTTGG - Intergenic
1190711921 X:53077684-53077706 GCCCCCTGCTGGGGCACAGGAGG + Exonic
1199595340 X:149502517-149502539 GCCTTCTGCAGGAGCTCAGCTGG - Intronic
1200074714 X:153545215-153545237 GCCCTATCCAGGGGCTCAGGTGG - Intronic
1200138573 X:153886344-153886366 GCCCACTCCGGGAGCTCAGCGGG + Intronic
1201400939 Y:13603101-13603123 GCCCACCACTGGAGCTGGGGAGG + Intergenic