ID: 924138523

View in Genome Browser
Species Human (GRCh38)
Location 1:240997738-240997760
Sequence CACGTGAATCCAGGAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60712
Summary {0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924138516_924138523 17 Left 924138516 1:240997698-240997720 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 924138523 1:240997738-240997760 CACGTGAATCCAGGAGACAGAGG 0: 2
1: 36
2: 1350
3: 14416
4: 44908
924138520_924138523 8 Left 924138520 1:240997707-240997729 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 924138523 1:240997738-240997760 CACGTGAATCCAGGAGACAGAGG 0: 2
1: 36
2: 1350
3: 14416
4: 44908
924138518_924138523 9 Left 924138518 1:240997706-240997728 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 924138523 1:240997738-240997760 CACGTGAATCCAGGAGACAGAGG 0: 2
1: 36
2: 1350
3: 14416
4: 44908

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924138523 Original CRISPR CACGTGAATCCAGGAGACAG AGG Intronic
Too many off-targets to display for this crispr