ID: 924145909

View in Genome Browser
Species Human (GRCh38)
Location 1:241074383-241074405
Sequence ATAGAGAAGGATACTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924145904_924145909 4 Left 924145904 1:241074356-241074378 CCCTTGAAAATTGGTGAGGATTG 0: 1
1: 0
2: 0
3: 21
4: 168
Right 924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 385
924145901_924145909 30 Left 924145901 1:241074330-241074352 CCAAATTGGTGTCAGATGCAAAG 0: 1
1: 0
2: 0
3: 10
4: 122
Right 924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 385
924145905_924145909 3 Left 924145905 1:241074357-241074379 CCTTGAAAATTGGTGAGGATTGA 0: 1
1: 0
2: 2
3: 17
4: 177
Right 924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG 0: 1
1: 0
2: 2
3: 31
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924145909 Original CRISPR ATAGAGAAGGATACTGAAGA GGG Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901056937 1:6452791-6452813 ACAGAGAAGGAAACTGAGGCTGG - Intronic
902477438 1:16695704-16695726 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
903082483 1:20821551-20821573 ATAGAGAAGTATACGTAATAGGG - Intronic
903082503 1:20821747-20821769 ATAGAGAAGTATACATAATAGGG - Intronic
903117663 1:21191483-21191505 AAAGAAAAAGAGACTGAAGAAGG - Intergenic
903597486 1:24506575-24506597 ATAGAGAAAGATAAAGCAGATGG + Intronic
904132309 1:28284039-28284061 ATAGATAAGGAAATTGAGGAGGG - Intergenic
904250766 1:29222693-29222715 GGAGAGAAGGAGAGTGAAGAGGG + Intronic
904448041 1:30590331-30590353 AGTGAGAAGGATACTCAAGGTGG + Intergenic
904877827 1:33670188-33670210 ATAGAGCAGGAGCCTGTAGAGGG - Intronic
907598114 1:55739071-55739093 ATAGAGAAGAGCACTGAATAAGG + Intergenic
907709640 1:56867343-56867365 AGAGAGAAGAATATTAAAGAGGG - Intronic
907949887 1:59172428-59172450 ATAGAGAAAGAAAATGAAAATGG - Intergenic
909437305 1:75657246-75657268 ACAGAGAATGAAAGTGAAGAGGG + Intergenic
909543498 1:76817340-76817362 ATAGTGAAGGACACTAAGGAGGG - Intergenic
909757282 1:79242368-79242390 ATATTGAAGTATACTGAAAAAGG + Intergenic
910052716 1:82994634-82994656 ACACAGAAGGATAAAGAAGATGG - Intergenic
910178562 1:84457227-84457249 GAAGAGAAGGAGAGTGAAGAAGG + Intergenic
910432751 1:87175245-87175267 ACAGATAAGGAAACTGAAGTTGG + Intergenic
910609035 1:89120165-89120187 ACAAAAAAGGATACTGAAGTTGG + Exonic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911745951 1:101442238-101442260 ATTGCGAAGGATACAGAAGAAGG + Intergenic
911912076 1:103650010-103650032 ATACATCAGGACACTGAAGAAGG - Intergenic
911916378 1:103701938-103701960 ATACATCAGGACACTGAAGAAGG + Intronic
911919491 1:103744148-103744170 ATACATCAGGACACTGAAGAAGG - Intronic
911959163 1:104277585-104277607 ATAGAAAAGGAAAATGCAGATGG + Intergenic
912268149 1:108180432-108180454 ATAGCAAAGGATAATGCAGAGGG - Intronic
912771577 1:112468960-112468982 ATACAGAAGACAACTGAAGATGG - Intronic
913286164 1:117228692-117228714 ACACAAAAGGATAATGAAGAAGG - Intergenic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
916934292 1:169611699-169611721 AAAGAGAAAGATACTGAGAAAGG + Intronic
918301113 1:183204688-183204710 TTAGAGGAGGAGACAGAAGAGGG + Intronic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919352513 1:196476492-196476514 ATAGATGAAGATAATGAAGAAGG - Intronic
919534896 1:198775330-198775352 ATAGAAAAGGATACTCAAACAGG - Intergenic
920982932 1:210855228-210855250 AGAGAGAGGGATACTGCAGAAGG + Intronic
921972033 1:221160303-221160325 ATAGATAAGGAAACTGAGGCTGG - Intergenic
922277071 1:224089015-224089037 AAAAAAAAGGATAATGAAGAAGG + Intergenic
924097863 1:240572836-240572858 AGAGAGAGGGATGCTGAAAAGGG + Intronic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
1062773983 10:130032-130054 ACAGAGAAGGGAACTGAAGCTGG + Intergenic
1063685693 10:8235612-8235634 TGAGAGAAGGCTCCTGAAGAAGG + Intergenic
1064482878 10:15757061-15757083 AGAGAGAAGGGGAATGAAGATGG + Intergenic
1064615547 10:17151882-17151904 ACAGAGAAGTAAACTAAAGAAGG + Intronic
1064955645 10:20905649-20905671 CTAGAAAAGGATACTGAAAATGG + Intronic
1066553265 10:36582743-36582765 ATAAAGCAGGATAATAAAGAAGG + Intergenic
1068223444 10:54074268-54074290 TTAGAGATGGATAGTGATGATGG - Intronic
1068384947 10:56314313-56314335 AGAGAGAATGCCACTGAAGATGG + Intergenic
1069581199 10:69568261-69568283 ATAGATAAGAGTACTGGAGATGG - Intergenic
1069941320 10:71957560-71957582 AAAGAGAGGGAAACTGAAAAAGG + Intergenic
1070424945 10:76277334-76277356 AAATACAAGGATACTGAGGATGG - Intronic
1070531955 10:77344667-77344689 ATAGAGAGGACTAGTGAAGAGGG - Intronic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072945696 10:99808165-99808187 AAAGCGCAGGATATTGAAGAGGG - Exonic
1072981067 10:100097985-100098007 ATAGGGAAAGACACTCAAGAAGG - Intergenic
1073480006 10:103780404-103780426 AAAGAGTAGGCTACTGCAGAAGG + Intronic
1073920277 10:108450519-108450541 GTACAGAAGGTTACTGAACAAGG + Intergenic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074140113 10:110664861-110664883 AGAGAGAGAGAGACTGAAGAAGG - Intronic
1074348645 10:112713163-112713185 AGAGAGAAGGAAACTAAGGAGGG - Intronic
1075391205 10:122093689-122093711 ATAGAGAGAGAAACTGAGGATGG - Intronic
1075918351 10:126189177-126189199 ATAGAGAAGGATCATGATGAAGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076253877 10:129004743-129004765 ACACAGAAGCATTCTGAAGAAGG + Intergenic
1077721860 11:4637853-4637875 ATGAAGAAGGAAACTGAAGCTGG + Intergenic
1077823995 11:5784243-5784265 ATAGAGAACCTTACTGAATAAGG - Intronic
1079150181 11:17891909-17891931 ATAGACAAGGAGACCAAAGAAGG - Intronic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080951857 11:37043088-37043110 ATAGATAAGTAAACTGAAGTTGG - Intergenic
1081346079 11:41988099-41988121 AGAGAGATGGAAACAGAAGAGGG + Intergenic
1081685171 11:45037319-45037341 ATAGAAGACTATACTGAAGAAGG + Intergenic
1083297659 11:61723724-61723746 ATAGACAAGGAAACTGAGGCAGG - Intronic
1083659041 11:64243719-64243741 ATGGAGAAGGGTAATGGAGATGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1087556880 11:99732592-99732614 CTAAAGAAGGATGCTGGAGAAGG + Intronic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087573295 11:99958818-99958840 ATACAGATGGATAGTGAAAATGG - Intronic
1088238320 11:107748627-107748649 ATAGAAAAAGATTCTGAAAAAGG + Intergenic
1088350958 11:108886985-108887007 ATAGAGAAGGATGGTGACTAAGG - Intronic
1088894180 11:114065293-114065315 ATAGAGAAGGAAACGGAAGCCGG - Intronic
1089135038 11:116242212-116242234 AGAGACAAGGCTACTGAGGATGG + Intergenic
1089610975 11:119668602-119668624 GAAGAGAAGGCTCCTGAAGAAGG - Intronic
1092693140 12:11137840-11137862 ATAGATAATGATAATGATGATGG + Intronic
1092964514 12:13628408-13628430 TCAGAGAAGGATCATGAAGAGGG - Intronic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093844509 12:23952137-23952159 ATAGAGAAAAAAAGTGAAGAAGG + Intergenic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1095843560 12:46721235-46721257 AAAGAGAAGGAGAATAAAGATGG - Intergenic
1096707423 12:53431090-53431112 AGAGTGATGGACACTGAAGATGG + Intronic
1098080758 12:66782849-66782871 ACAGAGAAGGAAACTGAAGATGG + Intronic
1098209067 12:68143452-68143474 AGAGAGAATTCTACTGAAGAAGG + Intergenic
1098915700 12:76254817-76254839 TTAGAGAAGGATTCAGATGAAGG - Intergenic
1099539850 12:83894235-83894257 ATAGAGAAAGAGAGAGAAGAGGG - Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099746003 12:86706169-86706191 ATACAGAAGGATTAAGAAGAAGG + Intronic
1100101011 12:91105820-91105842 ACAAAGAAGGATACAGAAGTAGG - Intronic
1100639285 12:96466390-96466412 ATAGTGAATAATCCTGAAGAAGG - Intergenic
1100698584 12:97121997-97122019 ACAGAGAAGTATAAAGAAGAAGG + Intergenic
1100957200 12:99922060-99922082 ATAGAGGAGGAAACTGAGCAGGG - Intronic
1103976505 12:124706056-124706078 CTAGAGAAGGATCCTTAGGAAGG + Intergenic
1104519240 12:129457733-129457755 AGAGAGAAAGAGAGTGAAGAGGG + Intronic
1106070788 13:26408818-26408840 TTAGGGAAGGACACTGAAAATGG - Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107594922 13:41953163-41953185 ATAAAGAAGGATACAGGATAAGG + Intronic
1107840967 13:44457859-44457881 ATACAGAAGCTAACTGAAGAAGG + Intronic
1107893840 13:44938419-44938441 ATACAGAAGTATAGTGTAGAGGG + Intergenic
1108112683 13:47093086-47093108 AGAGAGAAGACTCCTGAAGAAGG - Intergenic
1108943498 13:55989366-55989388 ATAAAGAAAGATATTGAACAAGG - Intergenic
1109220461 13:59636190-59636212 AAGGAAAAGGGTACTGAAGATGG + Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110081959 13:71325005-71325027 ATAGATGATGATAATGAAGATGG + Intergenic
1111398037 13:87693375-87693397 AGAGAGAAGGAGACTGAAAGGGG - Exonic
1112943962 13:104901695-104901717 TTAGAGGAGGTTACTGAAAATGG - Intergenic
1112950476 13:104989704-104989726 AAAGAGAAGGAAACTGAAATAGG + Intergenic
1115086098 14:29516708-29516730 ATAGAGAAAAATACTGATCAAGG + Intergenic
1115246039 14:31296353-31296375 ACAGATGAGAATACTGAAGATGG - Intronic
1116067640 14:40004344-40004366 ATAAAGAAGGAAGCTGAAGATGG - Intergenic
1116438175 14:44918735-44918757 ATAGAGAAATAAACTGAACATGG + Intergenic
1117018234 14:51541004-51541026 ATAGAGAAGTATTCTGAAATAGG - Intronic
1117102083 14:52360098-52360120 ATGGAAAAGGAAACTGAAAATGG + Intergenic
1118487093 14:66224549-66224571 AGAGAGAAGGGCACTGGAGAAGG + Intergenic
1118574732 14:67230997-67231019 ATCGAGAAGGCTACTGACTAAGG - Intergenic
1118701451 14:68437841-68437863 CCAGAGAAGGATTCAGAAGAGGG + Intronic
1118734799 14:68693641-68693663 AGAGAGAACTGTACTGAAGAAGG + Intronic
1118835130 14:69472450-69472472 ATAGAGCAGCATACAGAACATGG - Intergenic
1120625679 14:86823129-86823151 ATTGAGAAAGACACTGAAAATGG - Intergenic
1121512164 14:94520582-94520604 ATAGAGAAAGATACAGCAGGAGG + Intergenic
1122686628 14:103511277-103511299 ATAGAGCAGGAAACTGCAGAAGG - Intergenic
1126558270 15:50015237-50015259 ATAGAGAAAGAAAATGAAGAGGG + Intronic
1127579064 15:60320473-60320495 ATAGAGCAGGAGCCTGAAAAAGG - Intergenic
1127618883 15:60714029-60714051 AGAGAGAGAGATAATGAAGAAGG - Intronic
1128521509 15:68378003-68378025 ATAGAGAAGCATACTTCTGATGG + Intronic
1128718376 15:69927121-69927143 ATAGGTAAGGAAACTGAGGAAGG + Intergenic
1129173248 15:73820968-73820990 ATAGAGGAAGATATTGGAGATGG + Intergenic
1131040264 15:89258152-89258174 TTAGAGAAGGATATTCCAGATGG - Intronic
1131962884 15:97807891-97807913 ATAGAGGAGGAAACTGAGGCCGG - Intergenic
1134978875 16:18591433-18591455 GGTGAGAAGGATACTGAGGAAGG + Intergenic
1135627290 16:24007138-24007160 ATAGATGAGGAAACTGAAGCAGG - Intronic
1136000547 16:27289244-27289266 AAAGAGAAGGATACTGGAAGGGG + Intronic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138483217 16:57317924-57317946 ACAGAGAAGGAAACTGAGGCTGG - Intergenic
1138942989 16:61812885-61812907 ATAAAGAAGGAAACTTAAAAAGG - Intronic
1139189014 16:64840115-64840137 AAAGAGAAGGAGGCTGAAGGTGG - Intergenic
1142855299 17:2725856-2725878 GGAGAGAAGGATGCTGCAGATGG + Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1145893764 17:28438972-28438994 ATAGAGATGGATAGTGGTGATGG - Intergenic
1146118503 17:30166137-30166159 ATAGAGGAGGAAACTGAAACAGG + Intronic
1146202319 17:30869826-30869848 ATAGAGATAAATATTGAAGAAGG - Intronic
1149502381 17:57163746-57163768 AGAGAGAAGGATTTTGAAGAGGG + Intergenic
1149670324 17:58402537-58402559 TCAGAGAAGGATATTTAAGAGGG + Intronic
1150140437 17:62724056-62724078 AAGGAGAAGGATATGGAAGACGG + Intronic
1150261504 17:63795880-63795902 ATACAGAATGATACTGCATAAGG - Intronic
1150647620 17:66989353-66989375 ACGGAGAAGGACACAGAAGATGG + Intronic
1152254118 17:79227546-79227568 ATAGAGAAGGATTCAGCACAGGG + Intronic
1154954264 18:21240274-21240296 AAAGATAAGGACACTGAACAAGG - Intergenic
1155605503 18:27601128-27601150 AGAGAGAAGAATACTCAACAGGG + Intergenic
1156420061 18:36942093-36942115 ATAGGGAAGGTTGCTGAAGTGGG + Intronic
1156549709 18:38002954-38002976 AAAGAGAAGGATATTAAAGAGGG + Intergenic
1156664286 18:39386445-39386467 AGAGGCCAGGATACTGAAGACGG + Intergenic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1158033140 18:52991558-52991580 GTAGAGAGAGAAACTGAAGAGGG - Intronic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158779656 18:60632116-60632138 ATATAGAAGGATAACTAAGAAGG + Intergenic
1159564714 18:70035544-70035566 ATACAGAAATAAACTGAAGATGG + Intronic
1159797543 18:72863186-72863208 ATACAGCAGGAGGCTGAAGAGGG - Intronic
1159985948 18:74841104-74841126 ATAGTAAAGGGCACTGAAGAGGG - Intronic
1160356483 18:78231399-78231421 ACAGAGAAGGGTGCTGAACAGGG - Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1161985332 19:7650373-7650395 ATAGAGAATGAAAATGAAGGGGG + Intergenic
1164976627 19:32578146-32578168 ATAGAGGATGAAACTCAAGATGG + Intergenic
1202711457 1_KI270714v1_random:21530-21552 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
926365622 2:12130320-12130342 AGAGAGAAGGATGCTTAAAATGG - Intergenic
926868757 2:17389437-17389459 ATCAAGAAGGATACTTAAGCAGG + Intergenic
927589010 2:24336466-24336488 ATACAGTGAGATACTGAAGAGGG - Intronic
930138815 2:47930994-47931016 ATAGAGATGGATACTGGTGATGG + Intergenic
930550327 2:52826569-52826591 ATAGAGAAGGTTGATGAGGAGGG + Intergenic
931115069 2:59156874-59156896 AAAAGGAATGATACTGAAGATGG - Intergenic
932011957 2:67987640-67987662 TCAGAGAAGGATTATGAAGAGGG + Intergenic
933070203 2:77847337-77847359 TTAGATTAGCATACTGAAGATGG - Intergenic
935111118 2:100095019-100095041 ATAGAAAAAGCTACTGATGATGG - Intronic
935884411 2:107600262-107600284 AAAGAGATGGATTCAGAAGAGGG - Intergenic
935895032 2:107726598-107726620 GGAGAGAAGGAGAGTGAAGAAGG + Intergenic
936123857 2:109770143-109770165 ATAGAAAAAGCTACTGATGATGG + Intergenic
936220831 2:110601321-110601343 ATAGAAAAAGCTACTGATGATGG - Intergenic
936677592 2:114733184-114733206 ATAGAGGAAGTTACTGAAGTTGG - Intronic
936752056 2:115655539-115655561 ATTGAGTAGGAAACAGAAGATGG - Intronic
937556181 2:123159931-123159953 CTAGAGAAAGAAACTGAAAATGG - Intergenic
938576957 2:132613754-132613776 ATAGACACTGATACTGATGAGGG - Intronic
939095921 2:137833253-137833275 AGAGAGAAGGATAGAGAGGAAGG - Intergenic
939805327 2:146768740-146768762 ATAGAGAAGGTAAAAGAAGATGG - Intergenic
939861434 2:147425443-147425465 AAAGAGAAGGGTACATAAGAGGG + Intergenic
940283066 2:152007285-152007307 CTAGAGATGGATAGTGATGATGG - Intronic
940579714 2:155562601-155562623 ATATATGAGGATACTGAATATGG - Intergenic
941588654 2:167390656-167390678 ATCGAGAATGATGCGGAAGAAGG - Intergenic
941959428 2:171239129-171239151 ATAGGGAAGGAAACGGTAGATGG - Intergenic
944336743 2:198543071-198543093 ATAGAAATGGATGATGAAGATGG - Intronic
944377415 2:199062956-199062978 ATTGAGAAGGATACAAAAAATGG + Intergenic
947290015 2:228562565-228562587 AGACATAAAGATACTGAAGATGG - Intergenic
947591383 2:231388132-231388154 ACAGAGAAGGAAACTGAGGCAGG - Intergenic
1169288727 20:4330994-4331016 TTACAGAAGGATACAGAAAAGGG + Intergenic
1169501254 20:6162939-6162961 ATAGATCAGGAGAATGAAGAAGG - Intergenic
1170023099 20:11857841-11857863 ATAGAGAAGTGTACAGAATAGGG + Intergenic
1170243044 20:14191571-14191593 ATAGAGAAGGGTAGAGGAGAGGG + Intronic
1170524839 20:17227168-17227190 ATAGAGAAAGAGACTGAACAGGG - Exonic
1170610621 20:17909858-17909880 ACAGAGAAGGTTACAGAACAGGG + Intergenic
1171301667 20:24066454-24066476 ATAGAGCTGCATACTGAAAAGGG - Intergenic
1172427655 20:34866198-34866220 TTGGGAAAGGATACTGAAGATGG + Intronic
1172646911 20:36476211-36476233 AAAGAGACGGATAGTGATGATGG - Intronic
1173420404 20:42896148-42896170 ATAGATAAGGAAACTGAGGCAGG + Intronic
1173630844 20:44514071-44514093 ATAAAGGAGTATACTGAAGGCGG - Intronic
1174428388 20:50449553-50449575 ATAGAAGAGGATACTGGGGATGG - Intergenic
1176940917 21:14924629-14924651 CTAGAGAAGAATATTGAAGTTGG + Intergenic
1177093234 21:16797511-16797533 ATAGAGAGGGATCCCGCAGAAGG - Intergenic
1177542800 21:22517479-22517501 ATAGAGAAAGATAACGAAAAAGG - Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1177824867 21:26071343-26071365 CTGGAGAGGGAAACTGAAGATGG - Intronic
1178092870 21:29183067-29183089 AAAGAGAAGCACACTTAAGAAGG + Intergenic
1178191924 21:30292839-30292861 ATAGAGAAGGATATTCCAGAAGG - Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1184815961 22:46870165-46870187 TTAGGGGAGGAAACTGAAGAGGG + Intronic
1185071161 22:48657133-48657155 GTAGAGAGGGATAGAGAAGAAGG + Intronic
949841112 3:8321033-8321055 ATACAGTAGGACACTGAAGATGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951661260 3:25069131-25069153 AAAGAGAAGGGTAAGGAAGAAGG + Intergenic
951745241 3:25970998-25971020 AGAGAAAAGGAAAATGAAGAGGG - Intergenic
951874809 3:27411342-27411364 ATACAGAAGGTTCTTGAAGAAGG - Intronic
952065711 3:29567480-29567502 ATTAAGAAGGATAATGCAGAGGG - Intronic
952092939 3:29912316-29912338 TTAGACAAGGATACTGACAAAGG + Intronic
953927125 3:46988191-46988213 TTAAAGAAGGCTACTGAAGGTGG + Intronic
955839829 3:63100113-63100135 AGAGAGAGAGACACTGAAGAAGG - Intergenic
956689443 3:71862248-71862270 ATTGAGAAGGTTACTACAGAGGG - Intergenic
956881069 3:73511252-73511274 AAAGTGAAGTCTACTGAAGAAGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957891154 3:86361025-86361047 ATATAGAAGGGTATTGAGGATGG + Intergenic
957917924 3:86709435-86709457 AGTGAGATGGATACGGAAGATGG - Intergenic
959771195 3:110099066-110099088 ATAAATAAGAACACTGAAGATGG + Intergenic
960217280 3:115057092-115057114 AGACAGAAGGATAATGAAAAGGG - Intronic
960920668 3:122744561-122744583 ATACAGAAAGATGTTGAAGAAGG + Intronic
964677833 3:159303497-159303519 ATAGAGAGGGAGAGGGAAGAAGG + Intronic
966483445 3:180439706-180439728 AGAATGAAGAATACTGAAGATGG + Intergenic
967702436 3:192608946-192608968 AAAGAGGAGGATACTAAAAAAGG + Intronic
968727300 4:2253720-2253742 ACAGAGGAGGAGCCTGAAGAAGG + Intronic
969716540 4:8870878-8870900 ATAGGGAAAGATACAGGAGAAGG - Intronic
970108824 4:12615200-12615222 ATAGAGAAGAATACAGACCATGG - Intergenic
970244628 4:14047085-14047107 ATAGAGATGGATCTGGAAGATGG + Intergenic
970855357 4:20644812-20644834 ATAAAGAAGTGTACTGGAGAGGG - Intergenic
971628743 4:28960987-28961009 AAAGACAAGGCTACTGAAAAGGG + Intergenic
972105325 4:35478547-35478569 ATACACAAGAATACTGTAGAAGG - Intergenic
972345708 4:38190779-38190801 AGAGAGGAGGACATTGAAGAAGG + Intergenic
972372769 4:38440706-38440728 ATAGAGGAGGATAAAAAAGAAGG + Intergenic
974608340 4:64183026-64183048 AGAGAGAAAGATACTGAGGAGGG + Intergenic
974818453 4:67035879-67035901 AAAGAGAGGGATATTGATGAGGG + Intergenic
975747181 4:77486070-77486092 GTTGAGAAGGATACTGCTGATGG + Intergenic
976935398 4:90624980-90625002 AAAGAGTATGATACTGAAGCTGG - Intronic
976990563 4:91359660-91359682 AGAGAAAAGGATATTGAAAAAGG + Intronic
977370420 4:96127195-96127217 ATAGAGAAGGAAAGGGAAGAAGG - Intergenic
977700376 4:100015304-100015326 AAAGAGAAGGATAGAGGAGATGG - Intergenic
978431630 4:108639308-108639330 AGAGAGAAGAAAGCTGAAGATGG - Intergenic
978839458 4:113192881-113192903 ATAGAGAATGACACTGAATATGG - Intronic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979860743 4:125690605-125690627 ATAAAGAAGGATACTGATGTAGG - Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
982340944 4:154297997-154298019 ATAGGGAAGTATTCTGAAGATGG + Exonic
983537237 4:168871001-168871023 AAAGAGGAAGATACTGAAAATGG + Intronic
984310250 4:178049164-178049186 ATTGAGAAGGGTAGTGAAGTAGG - Intergenic
984743661 4:183192299-183192321 AAAGAGAAGGAAACTGAAGTAGG + Intronic
985268346 4:188171207-188171229 ATAGAGATGATGACTGAAGAGGG + Intergenic
985992277 5:3573243-3573265 ACAGAGAAGGAAAATAAAGAGGG + Intergenic
986296545 5:6444071-6444093 ATAGATAAGTAAACTGAAGCAGG - Intergenic
987188071 5:15445305-15445327 AGCGAGGAGGATGCTGAAGATGG + Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
990000369 5:50885060-50885082 ATGGAAATGGATACTCAAGAAGG - Intergenic
990088315 5:52007140-52007162 TTTGAGAAGGATAGTGGAGATGG + Intergenic
991005186 5:61821972-61821994 ATAGAGAATTATAGTGAAGGTGG + Intergenic
993100802 5:83537570-83537592 ACAGAGAGAGATACTGAAGTTGG + Exonic
995626497 5:114082971-114082993 ATAGAGATGGATAGTGGTGATGG + Intergenic
995817343 5:116186071-116186093 AGGGAGAAAGATAATGAAGATGG - Intronic
996857053 5:128020000-128020022 ATTGAGAATAACACTGAAGATGG - Intergenic
997606566 5:135179274-135179296 ATAGAGAAGGCTGCAGGAGAGGG + Intronic
997868891 5:137489550-137489572 ATAGAGATGGCTGCAGAAGATGG + Intronic
998809356 5:145950526-145950548 ATAGAGAGGGAAACAGGAGAAGG + Intronic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
999975011 5:156903630-156903652 CCAGAGAAGGAGACTGCAGACGG + Intergenic
1000573658 5:162948239-162948261 AGAGAGACAGAGACTGAAGAAGG + Intergenic
1000898307 5:166883023-166883045 ATAGAGAAAAATACTGACTAAGG + Intergenic
1001193316 5:169650388-169650410 ATATATAAGGAAACTGAGGAAGG - Intronic
1001432209 5:171671305-171671327 GTAGAAAAAGATACTGAAGAGGG - Intergenic
1002770257 6:284254-284276 ATGGAGGAGGAGACTTAAGAGGG + Intergenic
1002802901 6:543131-543153 GTAGAGAAGGATTTGGAAGATGG + Intronic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003624939 6:7732771-7732793 TTAGACAAGGAAAATGAAGAGGG + Intronic
1004417577 6:15438701-15438723 AGATAGAAGGATACTGTGGAGGG - Intronic
1004933251 6:20482372-20482394 ATAGAGAAAGACAGAGAAGATGG - Intronic
1004950586 6:20666555-20666577 ATAAAGAAGAATACCTAAGACGG - Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007312640 6:40958785-40958807 ATAGAGGAGGAGGCTGAATAGGG - Intergenic
1008374912 6:50780612-50780634 AGAGATAAGGATAGTTAAGATGG - Intergenic
1009310288 6:62142115-62142137 AGAGAGAAGAGTACTGATGAGGG + Intronic
1009395126 6:63190806-63190828 AGAGAGAAAGAAAGTGAAGAAGG - Intergenic
1010333865 6:74657832-74657854 ATAGAGAATGACATTGAAAAAGG + Intergenic
1010494562 6:76517479-76517501 ATAGAGAATAATACTGAGGCAGG + Intergenic
1010561684 6:77358870-77358892 ATAAAGAAGGAGACTAAAGAAGG + Intergenic
1011624327 6:89271115-89271137 AAAGAGAGGCATACAGAAGAAGG + Intronic
1012848549 6:104420152-104420174 AGAGAGAGAGAGACTGAAGACGG + Intergenic
1012900723 6:105003169-105003191 AAAGAGAAAGATACTGATAAAGG + Intronic
1013003874 6:106052082-106052104 CTGGAGATGGATACTGATGATGG + Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014233157 6:118926895-118926917 ATACAGAAGGATACTCGAGTGGG + Intronic
1015104000 6:129515078-129515100 CTAGAGAAGGATTCTGAATGAGG - Intronic
1015771107 6:136769548-136769570 AGAGAGAAGTATACAGAAGTGGG + Intronic
1017741165 6:157408011-157408033 ATATAGAAGTAGACTCAAGAAGG + Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1019580901 7:1762046-1762068 ATAGAAAGGAATAATGAAGAGGG - Intergenic
1020218230 7:6212352-6212374 CTAGAGATGGATAGTGATGATGG - Intronic
1021052096 7:15999439-15999461 AAAGAGAAGGATGATGAAAATGG + Intergenic
1021061211 7:16115139-16115161 ATAAAGAACCAAACTGAAGAGGG + Intronic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022521002 7:31006804-31006826 GTAGAGAAGGGTAGAGAAGAGGG - Intergenic
1022577498 7:31512098-31512120 TTAGAGAAGGCTAAGGAAGATGG + Intergenic
1022876299 7:34534202-34534224 ATAGACCAAGAAACTGAAGATGG + Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023267895 7:38427744-38427766 ATAGTGATGGATAATGAAGTAGG + Intronic
1024279375 7:47706819-47706841 AGAGAGGAGGATACAGGAGAAGG + Intronic
1024596040 7:50938632-50938654 ATAATGAAGGATGCTGAAGATGG + Intergenic
1027857613 7:83533082-83533104 GGAGAGAAAGATACAGAAGAAGG - Intronic
1028068668 7:86421101-86421123 ACAAAGGAGAATACTGAAGACGG - Intergenic
1028089853 7:86685587-86685609 ATAGATAAGGAAACTGAGAAAGG - Intronic
1028245348 7:88470048-88470070 ATAGAGAAAGATAGTAAAAATGG + Intergenic
1028532167 7:91849884-91849906 AGAGAAAAGAATACTGAAAAGGG - Intronic
1029294510 7:99529071-99529093 AGAGTGAAGGATGATGAAGAGGG - Intronic
1029961475 7:104692784-104692806 ATGGAGAAGGAAATTGCAGAAGG + Intronic
1031439466 7:121775576-121775598 AAATAGAAGGAAAGTGAAGATGG - Intergenic
1031550495 7:123105841-123105863 ATAGGGAAGAATACTGAGTAGGG + Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031813460 7:126401992-126402014 CTAGAGAAGGATGAAGAAGAGGG - Intergenic
1032691489 7:134291906-134291928 ACAGATAAGGTAACTGAAGATGG - Exonic
1033621311 7:143064207-143064229 CTAGAGAAGGAGACAGACGAGGG - Intergenic
1033853610 7:145528497-145528519 AGAGAGAAAAATACAGAAGAAGG + Intergenic
1033895237 7:146061061-146061083 ATGGAGAAAGACAGTGAAGATGG + Intergenic
1034072474 7:148199763-148199785 ATAGAGAGAGATACATAAGAGGG + Intronic
1034409397 7:150931845-150931867 AGAGAAAAGGATGCTGGAGAAGG + Intergenic
1035166968 7:156996677-156996699 CTAGACATGGATCCTGAAGATGG - Intronic
1035838206 8:2780980-2781002 ATATAGAAGTATGCTAAAGATGG + Intergenic
1036211462 8:6844369-6844391 AAAGTGCAGGATACAGAAGAGGG - Intergenic
1036211466 8:6844405-6844427 AAAGTGCAGGATACAGAAGAGGG - Intergenic
1036544108 8:9749802-9749824 AAAGAGAAGGATAATTCAGAGGG - Intronic
1036938617 8:13030235-13030257 ATAGAAAAGGAGCATGAAGATGG - Intronic
1038109476 8:24479561-24479583 ACAGAGAGGGAGACTCAAGATGG - Intronic
1038161964 8:25048158-25048180 ATAGAGAGGGAACATGAAGATGG + Intergenic
1038541827 8:28396186-28396208 CTATAGAAGGATAAGGAAGAAGG - Intronic
1038570793 8:28660626-28660648 CTAGAGAAGGATAGTGGTGATGG - Intronic
1038854379 8:31315093-31315115 ATAGAAAAGCAAACTGAAGCAGG - Intergenic
1041086591 8:54262295-54262317 GTAGAGAAAGTAACTGAAGAAGG - Intergenic
1041090792 8:54299423-54299445 GTAGTGAAGGATAAAGAAGAAGG + Intergenic
1042655262 8:71088835-71088857 AGAGAACAGGATACAGAAGAAGG - Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1044625353 8:94231224-94231246 GTGAAGAAGGATTCTGAAGATGG - Intergenic
1045375471 8:101569364-101569386 TTAGAGAAGGGCACTGAATAGGG + Intronic
1045510511 8:102809010-102809032 ATAGAGGAGGACCCAGAAGAGGG + Intergenic
1046334816 8:112771768-112771790 GTAGAGAAGAGTACAGAAGAGGG + Intronic
1047279747 8:123434782-123434804 GTAGAGAAGGTTGCTGCAGATGG + Intronic
1047560684 8:125985091-125985113 ATAGTGATGGATTCTGAAAATGG + Intergenic
1048007091 8:130428178-130428200 AGTGAGATGGACACTGAAGAGGG - Intronic
1050086405 9:1970938-1970960 ATGGAGTAGGATAATTAAGATGG + Intergenic
1050320023 9:4442820-4442842 ATAGAGAGGGAAAGCGAAGAGGG - Intergenic
1050766387 9:9140406-9140428 ATAGAGAGAAATACTAAAGAAGG + Intronic
1052050906 9:23849189-23849211 TTAGGAAAGGATGCTGAAGAAGG + Intergenic
1052231741 9:26162377-26162399 ATAGAGAATTTGACTGAAGATGG + Intergenic
1052483406 9:29062744-29062766 CTAGAGATGGATAGTGATGATGG + Intergenic
1052593098 9:30524112-30524134 ATACAGTTGGATACCGAAGAGGG + Intergenic
1053282304 9:36828567-36828589 ATAGGGAAGGCCCCTGAAGAGGG - Intergenic
1053518058 9:38748448-38748470 AATGAGAAGGAAACTGAAGTTGG - Intergenic
1055157088 9:73077396-73077418 ATAGAGAATGATAGTGGAGAAGG + Intronic
1055209352 9:73770663-73770685 GAAGAGAAGGACACTGCAGAGGG - Intergenic
1055759532 9:79591798-79591820 ATAGAAAAAGATACTTTAGAAGG + Intronic
1056067361 9:82950681-82950703 ATAGTGAAGGATGCTGAGGAAGG + Intergenic
1056184195 9:84117109-84117131 ATAAAGAAGGATCCTAAACACGG - Intergenic
1057868991 9:98704010-98704032 GTAGAGAATGATAGTGGAGATGG - Intronic
1058455462 9:105134128-105134150 GTAGATAAAGATACAGAAGATGG - Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059016726 9:110525619-110525641 ATAAAGAAGAATACAGTAGAAGG + Intronic
1059099604 9:111457365-111457387 AGAGAGAAAGAAACTGAAGAGGG + Intronic
1059817555 9:117934668-117934690 ATAAAGGAGGAAACTGAAGCAGG + Intergenic
1060328276 9:122640144-122640166 GTAAAGAAGGAAAATGAAGAAGG - Intergenic
1060472993 9:123964232-123964254 ATATATAAGGATATAGAAGATGG + Intergenic
1060530364 9:124344139-124344161 AGAGAGAAGGGCACAGAAGAGGG - Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061943973 9:133898168-133898190 ACAGAGAAGGAAACTGAGGCCGG + Intronic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1186580331 X:10810846-10810868 ATAGAGAGGGATATCAAAGAGGG - Intronic
1186614899 X:11175986-11176008 ATAGAAAAAGATCTTGAAGAAGG - Intronic
1187255278 X:17636316-17636338 ATAAAGAAGTATAGTGAAGGAGG - Intronic
1187481522 X:19660302-19660324 ATAAAGAAGCATTATGAAGATGG - Intronic
1188359849 X:29239921-29239943 GTAGATATGGCTACTGAAGAAGG - Intronic
1188612383 X:32116299-32116321 ATAGAAAATGATATTGAAGGTGG - Intronic
1189205393 X:39233990-39234012 ATAGGCAAGGATAATGAACAGGG - Intergenic
1189486826 X:41440228-41440250 CTAGAGAAGGATAGTGGTGATGG - Intergenic
1190364351 X:49677264-49677286 AGAGAGAAGACTTCTGAAGAAGG - Intergenic
1192778692 X:74271792-74271814 AGAGAGAAAGATAATGTAGAAGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195446187 X:104955588-104955610 CTAGAAAAGGATACTGAGAATGG - Intronic
1195713277 X:107792745-107792767 ACAGAGAAGGCTTCTGGAGAAGG - Intronic
1196122966 X:112069935-112069957 AGAGAGAATGATACTGCTGAAGG - Intronic
1196606053 X:117658310-117658332 CTAGAGATGGATAGTGATGATGG + Intergenic
1197964270 X:132040668-132040690 TTAGAGAAGGAAAGTGAATAGGG + Intergenic
1198003699 X:132469099-132469121 ATAGAGAAGAATACCGTGGATGG + Intronic
1198410164 X:136358848-136358870 ATAAAGAAGTGTTCTGAAGAAGG - Intronic
1198842981 X:140879107-140879129 ATATAGATGGATGCTGTAGAGGG - Intergenic
1199190317 X:144962865-144962887 ATGTAAAGGGATACTGAAGAAGG + Intergenic
1199342837 X:146702287-146702309 ATATGGAATGATACTGAAGTTGG + Intergenic
1199655744 X:149993817-149993839 AGAGAGAAGGATACGAAAAAGGG - Intergenic
1199730133 X:150623624-150623646 CTTGAGCAGGATCCTGAAGAAGG + Intronic