ID: 924149999

View in Genome Browser
Species Human (GRCh38)
Location 1:241120205-241120227
Sequence CCTGCCTACCTGGTTAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924149993_924149999 2 Left 924149993 1:241120180-241120202 CCATCCTCAGGCCTCTAAGGCAT No data
Right 924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 108
924149995_924149999 -9 Left 924149995 1:241120191-241120213 CCTCTAAGGCATTGCCTGCCTAC No data
Right 924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 108
924149990_924149999 12 Left 924149990 1:241120170-241120192 CCCAGGTGAGCCATCCTCAGGCC 0: 1
1: 0
2: 1
3: 24
4: 209
Right 924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 108
924149994_924149999 -2 Left 924149994 1:241120184-241120206 CCTCAGGCCTCTAAGGCATTGCC 0: 1
1: 0
2: 1
3: 17
4: 186
Right 924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 108
924149991_924149999 11 Left 924149991 1:241120171-241120193 CCAGGTGAGCCATCCTCAGGCCT 0: 1
1: 0
2: 1
3: 14
4: 220
Right 924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924149999 Original CRISPR CCTGCCTACCTGGTTAAAAT GGG Intronic
901942065 1:12670294-12670316 CCTGCCTGCCTGTTTCAAGTGGG + Intergenic
907342526 1:53746587-53746609 CCTGCATTCCTAGTTTAAATTGG - Intergenic
911526167 1:98989169-98989191 ACAGCCTATTTGGTTAAAATGGG + Intronic
911671862 1:100616564-100616586 CCTGCCTACATGGTTAATCTAGG + Intergenic
913117311 1:115709272-115709294 CCTGCCTTCCTGGTCAAAAAGGG - Intronic
913515228 1:119599778-119599800 GCTGCCTACCAGGGTAAATTGGG + Intergenic
915096591 1:153466855-153466877 TCTGACTAACTGGCTAAAATTGG - Intergenic
915552469 1:156643061-156643083 TCTGCCTACATGGTTCTAATAGG + Intronic
915627277 1:157122684-157122706 CCAGCCTCCCTGGTTAGATTGGG + Exonic
917553062 1:176055640-176055662 TATGCCTATCAGGTTAAAATTGG - Intronic
919300586 1:195758460-195758482 CCTGCATAACTTTTTAAAATTGG - Intergenic
920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG + Intronic
921714743 1:218406466-218406488 CCTGCGGATCTTGTTAAAATGGG - Intronic
921847292 1:219897713-219897735 CCTGCCTTCCAGGTTAAGGTGGG - Intronic
922761761 1:228137239-228137261 ACAGGCTACTTGGTTAAAATGGG + Intergenic
924149999 1:241120205-241120227 CCTGCCTACCTGGTTAAAATGGG + Intronic
1064252923 10:13720680-13720702 CCTGGCTACCTTGTTAACAGTGG - Intronic
1064582214 10:16806154-16806176 CCTGTTTCCCTGGTTCAAATGGG + Intronic
1064977521 10:21134033-21134055 CCTGCCTACATGGTGAAATTTGG + Intronic
1066525840 10:36278470-36278492 GCTGCCTTCCTGGCTAGAATTGG + Intergenic
1074296352 10:112192906-112192928 CCTGCCCGCCTGGGTTAAATTGG + Intronic
1074899208 10:117802135-117802157 TCTGGCTGCCTGGTTCAAATAGG - Intergenic
1075901224 10:126043979-126044001 CCTGCCCACCTGGTTACCAAGGG + Intronic
1084245236 11:67852497-67852519 CCTGCCTCCCTGGTAAAGAGAGG + Intergenic
1093040872 12:14377936-14377958 CCTGCCTACCAGGATAAAATTGG - Intronic
1100898320 12:99210696-99210718 ATTGGCTACTTGGTTAAAATGGG + Intronic
1101967953 12:109293777-109293799 CCTGCTTGGCTGGTTGAAATAGG + Intronic
1105399391 13:20074836-20074858 CCTTCCTTCCTTTTTAAAATAGG + Intronic
1110343755 13:74422463-74422485 TCTGTCTACCTGGTTAAAGATGG - Intergenic
1111168486 13:84493977-84493999 CCTACCTACTTGGTGAAAGTTGG - Intergenic
1112668818 13:101611543-101611565 GATGCCTACATGTTTAAAATGGG + Intronic
1114247309 14:20926825-20926847 CCTGCAGAACTGGTTAAAATAGG + Intergenic
1116144720 14:41049753-41049775 CATTCCTACCTGGTAAAAAGAGG - Intergenic
1117725680 14:58670976-58670998 CCTGCCTACATTGTTATATTTGG - Intergenic
1120538031 14:85721451-85721473 CCTGCCTAACTGCTTTAAACTGG + Intergenic
1120898550 14:89556461-89556483 CCTGCCTACCCAGTGAGAATAGG - Intronic
1121399271 14:93657789-93657811 CCTGCCTACAGGGTTAATAAAGG + Intronic
1126837667 15:52683705-52683727 ACTGCCTAACTGCTTAAACTTGG - Intronic
1127688182 15:61368853-61368875 CCTAACTACCAGGGTAAAATGGG + Intergenic
1130302165 15:82688608-82688630 CCTTCCTACCTGCCTAAAATTGG - Intronic
1135487450 16:22878715-22878737 CCTGACCACCTGTCTAAAATTGG - Intronic
1135965059 16:27028663-27028685 CCTCTCTCCCTGGTTAAACTTGG + Intergenic
1147793335 17:43026277-43026299 CCTGCCTACCTGGGAAAGTTGGG + Intronic
1147845710 17:43402685-43402707 CTTCCCTACCTGCTTAAAACAGG + Intergenic
1148257760 17:46150814-46150836 ACTGCCTACCTGGGAAAACTAGG + Intronic
1156769330 18:40699808-40699830 CCTGACTACCTGAATAATATGGG - Intergenic
1160004719 18:75061433-75061455 CCTGCCTTGCTGGATAAAACAGG - Intronic
1160409200 18:78663583-78663605 CCTGACTTCATGTTTAAAATTGG - Intergenic
1161428323 19:4216641-4216663 CCTGCGTAGCTGGTCAAACTCGG - Exonic
1164014599 19:21242266-21242288 CCTGCCTACATGGCTACAAATGG - Intronic
925370733 2:3343429-3343451 CCTGCCTAGCTGGTGTTAATGGG - Intronic
925393874 2:3518762-3518784 CCTGCCTGCCTGGCTAACCTCGG - Intronic
926935382 2:18082579-18082601 CCTGCCTCTTTGGTTCAAATGGG - Intronic
930056188 2:47253945-47253967 CCAGCCTACCTGGTAGAAATAGG - Intergenic
931707660 2:64960714-64960736 CCTCGATACCTGGATAAAATTGG + Intergenic
933467079 2:82666063-82666085 CCTGCCTTCCTAGTTAACAAAGG - Intergenic
934899468 2:98146497-98146519 TCTGCCTACTTGGTTAAGAGAGG - Intronic
937332349 2:121039390-121039412 CCTGCCTCCCTGGTTAAGCGAGG + Intergenic
937928658 2:127187944-127187966 CCTGCCTCCCAGGGTAAAACTGG + Intronic
937928789 2:127188707-127188729 CCTGCCTCCCAGGGTAAAACTGG + Intronic
940523511 2:154782193-154782215 CCAGAATACCTGGTTAAACTTGG + Intronic
940557804 2:155253852-155253874 CTTGCCTACCTGGTTACACAAGG - Intergenic
947921941 2:233884343-233884365 CCTCCATACCTTGTCAAAATAGG + Intergenic
1170127489 20:12980930-12980952 CCTACTGACCTGGTGAAAATGGG + Intergenic
1172706276 20:36884444-36884466 CCTGACTACCTGATTTAAAATGG + Intronic
1181780672 22:25190771-25190793 CCTTCATACCTGGTCAAACTTGG - Exonic
1182427139 22:30279856-30279878 CATGTCCACCTGGGTAAAATAGG + Intergenic
1184734351 22:46389281-46389303 CCCGCCTACCTCGTGAAAGTCGG + Exonic
950022866 3:9800824-9800846 CCTGCTTTCCTTGCTAAAATGGG + Intronic
950688273 3:14634673-14634695 CCTGCCTTTCTGCTTAACATTGG + Intergenic
974264214 4:59563502-59563524 CCTATCTACCTGGTTAAACAAGG + Intergenic
974759201 4:66253370-66253392 CCTGCCTAACTTTTTAAAAGTGG - Intergenic
977246754 4:94640429-94640451 CCTGATGACCTGGTTACAATGGG - Exonic
980539729 4:134177746-134177768 CCTGCCTACCTGGTTACCTCTGG - Intergenic
980791796 4:137630618-137630640 CCTGTGTACTTGGCTAAAATAGG + Intergenic
981276943 4:142911708-142911730 ACTGCCTACCTCTTTAGAATGGG - Intergenic
981944699 4:150327503-150327525 CATGCCTCCCTGATTAAAAGGGG + Intronic
982147132 4:152407244-152407266 CCTCCCCACATGTTTAAAATTGG + Intronic
983821807 4:172203564-172203586 CTTGCCTCCCAGGTTAAAAATGG - Intronic
984528420 4:180885267-180885289 CCTGCCTACCTGATAATACTTGG - Intergenic
986275633 5:6272638-6272660 CCTGCCTACGTTGTCACAATGGG - Intergenic
987628944 5:20442676-20442698 CCTGCCTACCAAGTTTTAATTGG + Intronic
988122466 5:26984069-26984091 TCTGCCTTCATGGTTACAATTGG - Intronic
989711412 5:44401887-44401909 CCTTCCTAACTGGGTAAACTGGG + Intergenic
993712236 5:91237046-91237068 TCAGCCTACTTGGTTAAAATGGG - Intergenic
996440586 5:123485788-123485810 ACTGCCTGGCTGGTTAGAATGGG + Intergenic
999651942 5:153776456-153776478 AATGCCTACCTGGTTAAGAAAGG + Intronic
1003999003 6:11575824-11575846 GCTGCCTATCAGGTTAACATTGG + Exonic
1008837358 6:55851215-55851237 CCTGTCTAGCTGCTTAGAATGGG - Intronic
1020523600 7:9227949-9227971 CCTGTCTAGCTGGTGGAAATAGG - Intergenic
1021140620 7:17020040-17020062 CCTGCCTACCTGGCGATAATAGG + Intergenic
1021491210 7:21221313-21221335 ACTGCCTACCTGGCCAACATTGG - Intergenic
1023691239 7:42790118-42790140 CCTTCCTTACTGGTTTAAATTGG + Intergenic
1024500837 7:50103713-50103735 CCTGACAACCTGGTTAGACTAGG + Intronic
1024861528 7:53848264-53848286 CCTGTCTACCAGGTTTAAACAGG + Intergenic
1026291767 7:69013400-69013422 CCTGCCTGCCTGCTTGAACTTGG - Intergenic
1030941421 7:115654780-115654802 TCTGTCTAGCTAGTTAAAATTGG - Intergenic
1031776044 7:125910546-125910568 GCCGCTTACCTGATTAAAATTGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1033002378 7:137520916-137520938 CCTGGCTACCTGTGTAAAAGAGG - Intronic
1037348472 8:17923811-17923833 CCTACCTATCTAGTTAGAATTGG + Intronic
1039384863 8:37126467-37126489 CCTGCCTGCCTGCTTAAGCTGGG - Intergenic
1040896983 8:52378541-52378563 CCTGCCCTCCTGGCTAAACTAGG - Intronic
1041031507 8:53740677-53740699 CCTTTCTACCTGCCTAAAATAGG - Intronic
1041173596 8:55170695-55170717 TATGCCTGCCAGGTTAAAATGGG - Intronic
1044960026 8:97521593-97521615 CCTGCCTTCTTATTTAAAATAGG + Intergenic
1045974871 8:108120931-108120953 CCTGGCTATCTGCTTGAAATGGG - Intergenic
1046033479 8:108811953-108811975 GCAGGCTACTTGGTTAAAATGGG + Intergenic
1046060561 8:109134551-109134573 CATGCCTACCTGGCAGAAATGGG + Intergenic
1049760458 8:144329859-144329881 CCTGCCTACCTGGTTACCAGGGG + Intergenic
1050127755 9:2377044-2377066 CCTGCCTGCCTGCTTGAGATGGG - Intergenic
1050178169 9:2891123-2891145 CCTGCCTGCCTGCTTGAACTGGG - Intergenic
1053344060 9:37364995-37365017 CTTGCTTACCTGGATACAATGGG - Intergenic
1055730868 9:79278273-79278295 CCTACCCATCTTGTTAAAATGGG + Intergenic
1061068111 9:128291642-128291664 CTGGCCAACCTGGTTAAACTTGG + Intergenic
1188154937 X:26730214-26730236 CCAAACTACCTGGTTAAAAATGG - Intergenic
1193480642 X:82023581-82023603 CCTGGTTACCTGGTTAAGGTGGG + Intergenic
1195400715 X:104458354-104458376 CCTGCCTGCCTGCTTAAGCTGGG + Intergenic
1198401636 X:136274227-136274249 CCTGCCAATTTGGTTAATATAGG + Intergenic