ID: 924156484

View in Genome Browser
Species Human (GRCh38)
Location 1:241181980-241182002
Sequence GATAGAGAGCAGGCCAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 573}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924156484_924156487 -10 Left 924156484 1:241181980-241182002 CCATTCCTGGCCTGCTCTCTATC 0: 1
1: 0
2: 4
3: 48
4: 573
Right 924156487 1:241181993-241182015 GCTCTCTATCTTAACAGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924156484 Original CRISPR GATAGAGAGCAGGCCAGGAA TGG (reversed) Intronic
900019019 1:174371-174393 GAAATAGAGCTGGCCAGGCATGG + Intergenic
900049276 1:532966-532988 GAAATAGAGCTGGCCAGGCATGG + Intergenic
900071509 1:774780-774802 GAAATAGAGCTGGCCAGGCATGG + Intergenic
900435852 1:2630189-2630211 GACAGGGAGCTGGGCAGGAAGGG + Intronic
900711861 1:4119526-4119548 GATGGAGAGCTGCCCAGGACAGG - Intergenic
900803299 1:4751028-4751050 GATAGTGACCAGGCCATGACGGG + Intronic
901200387 1:7463719-7463741 CGTAGAGAGCTGGCCGGGAAGGG + Intronic
901717922 1:11171742-11171764 GAGAGAGTCCAGGCCAGGCACGG + Intronic
901739290 1:11331738-11331760 AAGAGAGTTCAGGCCAGGAAGGG - Intergenic
901829842 1:11885730-11885752 GCTAAAGAGCAGGGCAGGACAGG + Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
903321852 1:22548080-22548102 GAGAGAGAGCAGGGGAGGAGAGG - Intergenic
903890579 1:26567667-26567689 ACTAGAGACCAGGCCAGGCATGG - Intronic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
905027243 1:34859350-34859372 ACTAGAGCGCAGTCCAGGAATGG + Intronic
905237994 1:36563453-36563475 GAAAGTGAGCAGGCCTAGAAGGG - Intergenic
905672542 1:39801506-39801528 GATACAGGCCAGGCCAGGCAAGG + Intergenic
906658959 1:47569015-47569037 GAAAGAGAGGAAGACAGGAAGGG - Intergenic
906959138 1:50404980-50405002 AAAAGTGAGCAGGCCAGGCATGG + Intergenic
907133234 1:52116080-52116102 GATAGAAACCAGGCTGGGAAGGG - Intergenic
907322531 1:53614359-53614381 GAGGGAGGGCATGCCAGGAAGGG + Intronic
907406338 1:54255780-54255802 GCTGGAGAGCTGGCCAGGCACGG + Intronic
907482996 1:54757641-54757663 TGGAGAGAGCAGTCCAGGAAAGG + Exonic
907650773 1:56292776-56292798 GATGCAGGGCAGGCTAGGAAAGG - Intergenic
908725766 1:67175223-67175245 GAGAAAGAGCTGGGCAGGAATGG + Intronic
909224847 1:73006174-73006196 GAAAAAGAGCAGGCCAGGCGTGG - Intergenic
910586392 1:88885146-88885168 TATAGATACCAGGCCAGGTATGG + Intronic
911044847 1:93619859-93619881 GCTAGAGAGCGAGCCAGGATGGG + Intronic
911130349 1:94381452-94381474 GATTGAGACCTGGCCAGGCATGG + Intergenic
911228740 1:95336981-95337003 GAGCCAGAGCAGGGCAGGAAAGG - Intergenic
911481530 1:98448345-98448367 GAGAGAGAGAAGGGAAGGAAAGG - Intergenic
911526234 1:98990085-98990107 AAGAAAGAGCAGGCCAGGCATGG + Intronic
915578000 1:156793915-156793937 AATATAGAGCAGGCCAAGCAGGG - Intronic
916750511 1:167719478-167719500 GGAAGAGAGAATGCCAGGAAAGG - Intergenic
917621562 1:176801651-176801673 GGAAGAGAGGAGGCCAGGGAAGG + Intronic
918146740 1:181763214-181763236 GATAGAGAGCAGGCATGGGAAGG + Intronic
918761973 1:188421139-188421161 GCTAGAAAGCAGGCCAGGAGTGG - Intergenic
919664977 1:200283078-200283100 AGTAGAGAGAAGGCCAGGCACGG + Intergenic
919977729 1:202623540-202623562 GCTTGGGAGCAGGCCGGGAAGGG + Intronic
920174898 1:204094556-204094578 GGCAGAGAGAGGGCCAGGAAGGG + Intronic
920456692 1:206107144-206107166 GACAGAGAGGAGGACAGGAGGGG - Intergenic
920807724 1:209250850-209250872 GTTAAGGAGCAGGCCAGGGAGGG + Intergenic
921426096 1:215002703-215002725 GAAGGAGAGCAGCCCAGGAAAGG + Intergenic
922059985 1:222079606-222079628 GATAGAAAGTGGGCAAGGAAAGG + Intergenic
922106875 1:222520241-222520263 GAAATAGAGCTGGCCAGGCATGG + Intergenic
922221760 1:223613679-223613701 GAGAGAGAGGAGGCCAGACAAGG + Intronic
922266425 1:223988663-223988685 GAAATAGAGCTGGCCAGGCATGG + Intergenic
922366215 1:224866480-224866502 GATGAGGAGCAGGCCAAGAAAGG + Intergenic
923400550 1:233612170-233612192 GTTACAGAGCAGGACAGGGAAGG + Intergenic
923624867 1:235605810-235605832 GTCAGGGAGCAGACCAGGAAGGG + Intronic
924039654 1:239971828-239971850 GAAAGAGAGAAGGAAAGGAAAGG + Intergenic
924156484 1:241181980-241182002 GATAGAGAGCAGGCCAGGAATGG - Intronic
1063326048 10:5103176-5103198 GATGAAGAGGAGGCCAGGAGCGG - Intronic
1064709824 10:18111761-18111783 AATAGAGAGGAGGCCACGCACGG + Intergenic
1064728282 10:18303210-18303232 GAAAGGGAGAAGGCCAGGCATGG + Intronic
1065249283 10:23794377-23794399 GATAGAGAGTAGAACAGGATGGG - Intronic
1066398293 10:35048679-35048701 GATAGAGAGCTGGAGAGGAAAGG - Intronic
1066727311 10:38407100-38407122 GAAATAGAGCTGGCCAGGCATGG - Intergenic
1069446502 10:68477605-68477627 GATCAAGACCAGGCCAGGCACGG - Intergenic
1071603547 10:86970439-86970461 GAGAGAGGGCAGGTCAGGCAGGG - Intronic
1072518600 10:96210659-96210681 GACAGAGGGCAGGCCAGGAGGGG + Intronic
1072784395 10:98269809-98269831 GATAGAGACCAGGGAATGAATGG + Intergenic
1073140441 10:101243606-101243628 GACAGAAGGCAGGCCAGGACTGG - Intergenic
1074325369 10:112446247-112446269 CAAAGAGAGCATGCAAGGAAAGG + Intronic
1074548203 10:114418548-114418570 GAGAGAGAGCAAGACAGAAAGGG - Intergenic
1074870793 10:117574461-117574483 GACAAGGAGCAGGCCAGGAAGGG - Intergenic
1075124730 10:119690663-119690685 AACAGAGAGTAGGCCAGGCACGG + Intergenic
1075446834 10:122519107-122519129 CATTGAGAGCAGGAGAGGAATGG - Intergenic
1075902450 10:126053995-126054017 GACTGAGACCAGGCCAGGTACGG - Intronic
1076370622 10:129950460-129950482 GATAGAGAGCACTGCAGGGAGGG - Intronic
1076375182 10:129978953-129978975 GATAGAGAGCAGCTCTGGACAGG + Intergenic
1076975620 11:169561-169583 GAAATAGAGCTGGCCAGGCATGG + Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077279533 11:1736177-1736199 GAAAGAGAGGAAGACAGGAAGGG + Intronic
1077847655 11:6043061-6043083 AAGAGAGATCAGGCCAGGCACGG + Intergenic
1078081059 11:8205008-8205030 CTGAGAGGGCAGGCCAGGAAGGG + Intergenic
1078211351 11:9272385-9272407 AAGAGAGAGCAGGCCAGGCATGG + Intergenic
1079505317 11:21146607-21146629 GATACAGTGCAGGACAGAAAAGG + Intronic
1080026859 11:27624352-27624374 GACAGTGAGCTGGCCTGGAATGG + Intergenic
1080040007 11:27749618-27749640 GCTACAGAGCAGAACAGGAATGG - Intergenic
1081574394 11:44310170-44310192 GAGAGCGAGCAGGCCGGGCAAGG - Intergenic
1081869347 11:46376277-46376299 GATAGAGTGGGGGCCAGGGAGGG - Intronic
1081893272 11:46563073-46563095 AATAGGAAGCAGGCCAGGCACGG - Intronic
1083580720 11:63823509-63823531 GAGAGTGTGCAGGCCAGGAGAGG + Intronic
1083676130 11:64326099-64326121 GATAAAAATCAGGCCAGGCATGG + Intergenic
1084009685 11:66340620-66340642 GAAGGAGACCAGGCCTGGAAAGG - Intronic
1084055138 11:66627052-66627074 GATGGGAAGGAGGCCAGGAAAGG + Exonic
1084573276 11:69972857-69972879 GATAGGGGCCAGGCCAGGGAGGG - Intergenic
1084858775 11:72004959-72004981 GGTAGAAAGCAGAACAGGAAAGG - Intronic
1084936359 11:72589080-72589102 GTTACAGAGCAGCCTAGGAATGG - Intronic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1085479439 11:76809194-76809216 GATAGGGAGGAGGCCTGGACAGG - Intergenic
1085563677 11:77493581-77493603 GACTGAGTGCAGGCCAGGCATGG - Intergenic
1085893830 11:80612930-80612952 GAGAGAGAGCAGGAGAGGGAAGG + Intergenic
1086750246 11:90484645-90484667 GATAGTGTGAAAGCCAGGAAAGG + Intergenic
1087970050 11:104469376-104469398 GAGAGAGAGGAGGCCAGGAAAGG + Intergenic
1088810220 11:113387190-113387212 GATAGAGCGCAGCCCAGGAAGGG + Intergenic
1089198979 11:116711865-116711887 GAGAGAGAGCAGGCCCAGGAAGG - Intergenic
1089580685 11:119480356-119480378 GAAAGAGAGGACACCAGGAAGGG - Intergenic
1089771900 11:120809084-120809106 GACAGAGAGCAGTTCAGGGAGGG - Intronic
1090053305 11:123400184-123400206 AATAGAAATCAGGCCAGGCATGG + Intergenic
1090242098 11:125191389-125191411 CAAAGAGAGCAAGCCAGGAGTGG + Intronic
1090669819 11:128938408-128938430 GAGAGAGAGCAGGACAGAGAAGG - Intronic
1090711796 11:129392978-129393000 GACAGATAGAAGGCCAGAAATGG + Intronic
1091120987 11:133057422-133057444 GGCACAGAGCAGGACAGGAAGGG - Intronic
1092130393 12:6108001-6108023 TATACAAAGCAGGCCAGGCACGG + Intronic
1092157889 12:6296196-6296218 GATGGAGAACAGGACAGGATAGG + Intergenic
1092244611 12:6856536-6856558 GGTAGGGAGCAGGACAGGAAGGG + Intronic
1092720958 12:11440051-11440073 AACAGAGAGCAGGTCAGTAATGG + Intronic
1092746336 12:11675858-11675880 GAGAGAGAGAAGGAAAGGAAGGG + Intronic
1092814375 12:12300253-12300275 GATTGAAAGCAGGCTAGGCATGG - Intergenic
1093273315 12:17093511-17093533 GACAGTGAGCAGGACAGGGAAGG - Intergenic
1093684578 12:22041655-22041677 GAGAGAAAGAAGGCCAGGCACGG + Intergenic
1094612518 12:32007887-32007909 GTTACAGAGCAGGCCAGGCGCGG - Intergenic
1095502900 12:42860074-42860096 GAGAGAGAGGAGGGAAGGAAAGG - Intergenic
1096267482 12:50135217-50135239 GAGAGAGAGGAGGACAGGGAGGG + Intronic
1096622057 12:52871165-52871187 GATTGAGGTCAGGCCAGGGAGGG + Intergenic
1096988606 12:55779854-55779876 GAAATAGAACAGGCCAGGCATGG + Intronic
1097146010 12:56939807-56939829 GTTAGAGAGCAGGCCTGCACTGG + Intergenic
1097151726 12:56984284-56984306 GTTAGAGAGCAGGCCTGCACTGG + Intergenic
1097546954 12:61015217-61015239 GAAAGAGAGGAGGACAGGGATGG + Intergenic
1099202933 12:79695917-79695939 GAAAGAGAATAGGCCAGGCACGG - Intergenic
1100291799 12:93222218-93222240 GAGAGGGAGCAGGAGAGGAAGGG + Intergenic
1100863356 12:98830535-98830557 AACAGAGGGCAGGACAGGAAAGG - Intronic
1102394030 12:112573197-112573219 AACAGAGATCAGGCCAGGCATGG - Intronic
1102403684 12:112653411-112653433 TATAGAGAGCTTACCAGGAATGG + Intronic
1102414483 12:112748623-112748645 GAGTGGGAGCAGGCCAGGCATGG - Intronic
1103499295 12:121388525-121388547 GATAGAGAGCAAACCAGAAGTGG + Intronic
1103898623 12:124291545-124291567 GAAATAAAGCAGGCCAGGAACGG - Intronic
1104105353 12:125653944-125653966 AGGAGAGAGCAGTCCAGGAATGG + Exonic
1106449710 13:29869272-29869294 GAAAGAGAGCAGGCCAGTCCGGG + Intergenic
1106878986 13:34108362-34108384 GATAGAGAGCAAAGGAGGAAGGG + Intergenic
1107294668 13:38896325-38896347 GAGAGAGGACTGGCCAGGAAGGG - Intergenic
1107454870 13:40545839-40545861 GAGAGAGAGAAGGCAAGGGAAGG + Intergenic
1107649041 13:42525947-42525969 AATAGAGAGGAAGCTAGGAAGGG + Intergenic
1108040735 13:46337443-46337465 GAGAGAGAGCGGACCAGGCACGG - Intergenic
1108376197 13:49816286-49816308 GAAAGAGAGAAGGAAAGGAAAGG - Intergenic
1108691012 13:52859279-52859301 GATAGAGATTTGCCCAGGAAAGG + Intergenic
1108912394 13:55571993-55572015 TATAAAGAGCAGGCCAGCTAAGG + Intergenic
1112324400 13:98433797-98433819 GAGAGAGAGCTGGCCAGGAAAGG - Intronic
1112422392 13:99264336-99264358 GACAGAGAACAGGCTAGGGAAGG + Intronic
1113657715 13:112079232-112079254 CAGAAAGAGCAGGCCAGGCAGGG + Intergenic
1114350465 14:21844850-21844872 GAAAGAGAGCAGGTGATGAAGGG - Intergenic
1114553118 14:23545574-23545596 ATTAGAGAGAAGGCCAGGGAAGG - Intronic
1114657085 14:24322747-24322769 GGCAGGGAGAAGGCCAGGAAGGG - Intronic
1114683161 14:24504472-24504494 GAGAGAAAACAGGGCAGGAAAGG - Intronic
1115595788 14:34907983-34908005 GATAAAGAACAGGCCGGGCACGG + Intergenic
1115625388 14:35186879-35186901 GATAGAAAGAAGGCCAGACATGG - Intronic
1115890639 14:38024167-38024189 GATAGGGAGAAGCCCAGGAAAGG - Intronic
1116970415 14:51059015-51059037 GTTAGAGAACAGGCCTGTAAAGG + Intronic
1117129254 14:52668253-52668275 TATAAACAGCAGGCCAGGCATGG + Intronic
1117429896 14:55646534-55646556 GAAAGAGAGAAGGAAAGGAAAGG - Intronic
1117725444 14:58668670-58668692 GATACAGAGCAGAGTAGGAACGG + Intergenic
1117730266 14:58715122-58715144 CACAGAGACCAGGCCAGGGAGGG - Intergenic
1117993886 14:61460764-61460786 GACAGAGAGCATGCCATGATGGG - Intronic
1118303051 14:64632360-64632382 CCGAGAGAGCAGGCCAGGATAGG + Intergenic
1119276793 14:73364208-73364230 AATATATAGCAGGCCAGGCATGG + Intronic
1119523250 14:75301858-75301880 GAGACAGAGGAGGGCAGGAAGGG - Intergenic
1120085100 14:80263167-80263189 GAATGAGACCAAGCCAGGAAGGG + Intronic
1121396596 14:93629341-93629363 CATAGAGTGCAGGCCAGTAAGGG + Intronic
1121450250 14:94002442-94002464 GATACAGAACAGGCCAGGTGTGG - Intergenic
1121612266 14:95289698-95289720 GAAAGTGGGCAGCCCAGGAATGG - Intronic
1121682573 14:95805977-95805999 GATAGGAAGCAGGAGAGGAAGGG - Intergenic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1123159236 14:106261635-106261657 GACACAGAGCAGGCCTTGAAAGG - Intergenic
1123160349 14:106272505-106272527 GACAGAGAGCAGGCATTGAAAGG - Intergenic
1124493373 15:30171904-30171926 GCTTGGGAGCACGCCAGGAAGGG + Intergenic
1124646910 15:31443691-31443713 AATAGAGAACTGGCCAGGCATGG - Intergenic
1124750161 15:32366421-32366443 GCTTGGGAGCACGCCAGGAAGGG - Intergenic
1124832077 15:33158894-33158916 GATAGATTTCAGGCCAGGCATGG + Intronic
1124853126 15:33360298-33360320 GATAGAAAGCAGGTCAGTGACGG - Intronic
1125501395 15:40242063-40242085 GGTAGACAGCAGGCCAGCAGCGG + Intronic
1125757312 15:42072348-42072370 GACAGAGAGCCGCCCTGGAACGG - Exonic
1126334228 15:47569307-47569329 GACAGAGGGCAGGGCAGAAAGGG - Intronic
1126338288 15:47610840-47610862 GAAAGAAAGCAGGACAGGAAAGG + Intronic
1127503018 15:59572216-59572238 GATAAAAAGTAGGCCAGGCATGG - Intergenic
1128048376 15:64640165-64640187 AAGAGAGAGGAGGCCAGGCACGG - Intronic
1128055726 15:64698802-64698824 GTTACAGACCAGGCCAGGCATGG - Intronic
1128499285 15:68216201-68216223 GAGAGAGATGAGGCCAGGAGTGG - Intronic
1128930613 15:71702024-71702046 GATGGAGAGGAGGCCTGGCAGGG - Intronic
1129113451 15:73351787-73351809 GGCAGAGTCCAGGCCAGGAAAGG - Intronic
1130144036 15:81258691-81258713 GAGAGAGAGCAGGTCAGGACAGG - Intronic
1130576680 15:85099137-85099159 CATTGAGAACTGGCCAGGAAGGG - Intronic
1130834588 15:87637009-87637031 GATACAGAGCAGGCCAAGTGTGG + Intergenic
1131095910 15:89654399-89654421 CAGAGAGAGGAGGCGAGGAAAGG - Intronic
1131355504 15:91742513-91742535 GGTAGAGACTAGGGCAGGAAGGG - Intergenic
1131370342 15:91875779-91875801 AGTAGAGAGCAGGCCAGGTTTGG - Intronic
1132085318 15:98903891-98903913 GACAGAAAGCAGACCAGGGATGG + Intronic
1132143998 15:99416163-99416185 CAGAGAAAGCAGGCCTGGAATGG + Intergenic
1132390693 15:101436245-101436267 GATGGAGGGAAGGCCACGAAGGG + Intronic
1133442341 16:5831309-5831331 GATAGAGAGAATGGCAGGGAAGG - Intergenic
1133819731 16:9225938-9225960 GAAAGAAAGCAGGCAAGGAAGGG - Intergenic
1133935820 16:10268343-10268365 GAAAGAAAGAAGGCCAGGTATGG + Intergenic
1133970129 16:10561450-10561472 GGAAGAGAGAAGGCCAGGGAAGG + Intronic
1134674054 16:16077008-16077030 GATAGAAAGCTGGCAAGAAAGGG - Intronic
1135059424 16:19258348-19258370 GAGATAGAGGAGGCCAGGCACGG + Intronic
1135120406 16:19761420-19761442 GGTACAGAGCAGGCTAGGGAGGG + Intronic
1135349217 16:21714798-21714820 GAAAGAGAGTTGGCCAGGCATGG - Intronic
1135396493 16:22135744-22135766 GATAAGGAGCAAGCCATGAAAGG - Intronic
1135605744 16:23823096-23823118 AATTGAGGGCAGGCCAGGCATGG + Intergenic
1136125347 16:28175403-28175425 GGCAGAGGCCAGGCCAGGAAGGG - Intronic
1136246331 16:28978300-28978322 GAGAGAGGGCAGGCCAGGTAGGG - Intronic
1136332532 16:29589773-29589795 AAGAGAGAGGAGGCCAGGCATGG + Intergenic
1136459634 16:30401580-30401602 TTTAGAAAGCAGGCCAGGCACGG - Intergenic
1137402254 16:48163212-48163234 GACAGAGGGCAGGGCAGGCAGGG + Intergenic
1138114215 16:54347640-54347662 GAAAGAGGGGAGGCCAGGAGTGG - Intergenic
1138441853 16:57040078-57040100 TATAGACAGCAGGCCAGGGCAGG + Intronic
1138487480 16:57355965-57355987 GATAGAAAGGAGGCCAGGCACGG - Intergenic
1138841961 16:60521063-60521085 AAAAGTGAGCAGGCCAGGCATGG + Intergenic
1138939763 16:61776101-61776123 GATAGAGAGGAGGATAGAAAAGG + Intronic
1139029550 16:62862520-62862542 GAAAGAAAGCAGGCCGGGCACGG - Intergenic
1139283226 16:65787523-65787545 GATAGAGAGAAGTACAGGATGGG + Intergenic
1139308091 16:66005242-66005264 AATAGAGAGCAAGAGAGGAAGGG - Intergenic
1139607214 16:68027888-68027910 GAGAGAGAGCAGGCCAGGCTGGG + Intronic
1139764399 16:69214815-69214837 GATAAAAAACAGGCCAGGCACGG - Intronic
1140730183 16:77849286-77849308 GACAGAGAGCATACCATGAAAGG + Intronic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1141604921 16:85147188-85147210 CACAGAGACGAGGCCAGGAAGGG - Intergenic
1141793291 16:86251167-86251189 GAGAGAGAGCAGGGGAGGGAGGG - Intergenic
1142120021 16:88382653-88382675 GCTGGAGCGCAGGCCAGGGATGG + Intergenic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142444639 16:90128092-90128114 GAAATAGAGCTGGCCAGGCATGG - Intergenic
1142462872 17:107373-107395 GAAATAGAGCTGGCCAGGCATGG + Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142545579 17:699942-699964 GACAGTGAACAGGCAAGGAAAGG + Intronic
1142809555 17:2388924-2388946 GCTCGAGAGCAGGCCAAGAAAGG - Intronic
1143085591 17:4413603-4413625 GAGAGAGAGAAGGAGAGGAAGGG - Intergenic
1143363094 17:6387338-6387360 CAGAGAGAGAAGGCCAGGCAGGG - Intergenic
1143807432 17:9440959-9440981 GATGGAGAGGAGGCCAGCCATGG - Intronic
1145884281 17:28371773-28371795 GAGAGCGAGCAGGCGAGGGATGG - Exonic
1145992873 17:29089782-29089804 GCCAGAGAGCAGGCCAGGCAGGG + Intronic
1146281546 17:31548534-31548556 CATAGAGAGGAGGCCAGACACGG + Intergenic
1146357566 17:32147031-32147053 AAAAAAGAGCAGGCCAGGCATGG - Intronic
1146499570 17:33352841-33352863 GCATGAGAGAAGGCCAGGAAGGG - Intronic
1146651097 17:34606891-34606913 GAAAGGAAGGAGGCCAGGAAAGG - Intronic
1146708238 17:35017936-35017958 GATAGAGAGCAGTCCAGCAGTGG - Intronic
1146775785 17:35614478-35614500 GACAAAAAGCAGGCCAGGCATGG - Intronic
1147194527 17:38756781-38756803 AAAAGAGATCAGGCCAGGCATGG - Intronic
1147552034 17:41450015-41450037 GAGAGAGAGCAGGAAGGGAAGGG + Intergenic
1147672875 17:42186770-42186792 GAAAGAGAGAAGGCCAGGCATGG - Intergenic
1147836856 17:43338985-43339007 GCTACTGAGCAGACCAGGAAAGG - Intergenic
1147838061 17:43349198-43349220 GCTACTGAGCAGACCAGGAAAGG - Intergenic
1148189041 17:45666204-45666226 GGTAGAGGGCAGTCCAGGCATGG + Intergenic
1148215446 17:45831709-45831731 GAGAGAGAGCGGGGCAGAAAAGG + Intronic
1148660387 17:49326438-49326460 GACAGAAAGTAGGCTAGGAAAGG + Intronic
1148925122 17:51077410-51077432 AATAGAGACAAGGCCAGGCACGG - Intronic
1149320965 17:55480193-55480215 CATAGTGAGCTGGACAGGAAAGG + Intergenic
1149440007 17:56666093-56666115 GAGAGAGAGAAATCCAGGAAAGG + Intergenic
1150427867 17:65091168-65091190 GCCAGTGAGCAGGCGAGGAAGGG - Intergenic
1150508150 17:65720081-65720103 GAAAGAGAGGAGGAAAGGAAGGG + Intronic
1150696263 17:67408277-67408299 GATAAAGTTCAGGCCAGGCATGG + Intronic
1151091254 17:71442701-71442723 AATAAAAAGCAGGCCAGGCATGG + Intergenic
1151102812 17:71575132-71575154 GTTAGAGGGGAGGCCAGGCACGG + Intergenic
1151207558 17:72519096-72519118 GAAGGAGGGCAGGCGAGGAAAGG + Intergenic
1151392389 17:73796271-73796293 TATAAAGAACAGGCCAGGCATGG + Intergenic
1151652568 17:75479175-75479197 GCAAGAAAGCAGGCCAGGCACGG + Intronic
1152335130 17:79696327-79696349 GAATGAGAGCTGGCCAGGAATGG + Intergenic
1152562657 17:81086297-81086319 GCCAGAGAGCGAGCCAGGAAGGG + Intronic
1153340179 18:3965655-3965677 AATAGAGTACAGGCCAGGCACGG + Intronic
1153457884 18:5298547-5298569 GTTACAGAGCAGCCCAGTAAGGG + Intergenic
1153647223 18:7205976-7205998 GAGAGAGAGGAGGAAAGGAAAGG - Intergenic
1154396615 18:13996763-13996785 GAAAGAGTCCAGGCCAGGCATGG - Intergenic
1155614901 18:27710743-27710765 GAAAGAAAGGAGCCCAGGAATGG - Intergenic
1155732170 18:29174329-29174351 GACATGGAGCAGGACAGGAAAGG + Intergenic
1155972163 18:32092640-32092662 GATACAGCGCGCGCCAGGAAGGG - Intronic
1157079969 18:44513442-44513464 GAGAGAGAGAAGGCAAGGCAAGG + Intergenic
1157256018 18:46140354-46140376 GAAAGAGAGAAGGAAAGGAAAGG - Intergenic
1157510566 18:48269252-48269274 GAAACAGAGCAGGCCGGGCATGG - Intronic
1158321423 18:56268386-56268408 GATACAGAGCAGGGTAGAAAAGG - Intergenic
1158733625 18:60054734-60054756 GAAAAATAGTAGGCCAGGAAGGG + Intergenic
1158799581 18:60890526-60890548 GTTAGGGAGCAGGGCAGGGAGGG - Intergenic
1159226112 18:65538222-65538244 GAAAGAGAGCAAACCAGGGAGGG + Intergenic
1160362759 18:78297555-78297577 GAAAGGGAGCAGGTCAGGGAAGG + Intergenic
1160560178 18:79751099-79751121 CACAGAGGGCAGGCCAGGGAGGG + Intronic
1160560250 18:79751300-79751322 CACAGAGGGCAGGCCAGGGAGGG + Intronic
1160606753 18:80057280-80057302 GAAATAGATCAGGCCAGGCATGG - Intronic
1160652576 19:239748-239770 GAAATAGAGCTGGCCAGGCATGG + Intergenic
1160875407 19:1294341-1294363 GATAGAGATCAGCCGAGGAAGGG - Intronic
1161100590 19:2419170-2419192 GAGAGAGAGAAGGAAAGGAAAGG - Intronic
1163034937 19:14564761-14564783 GAAAGGGAGCAGGGCAGGGATGG - Intronic
1163082376 19:14953285-14953307 GAGAGAGAGGAGGCGAGGCAGGG - Intronic
1163119901 19:15211181-15211203 GAAAGAGAGCAGGCCAGGCGTGG - Intergenic
1163407774 19:17134049-17134071 AGTAGAAAGCAGGCCAGGCATGG - Intronic
1163467593 19:17477532-17477554 GAAAGAAAGAAGGCCAGGCACGG - Intronic
1163726112 19:18924096-18924118 GAGAGGCAGCAGGCCAGGCACGG - Intronic
1165725039 19:38106782-38106804 GTTAGAGAGCAGCCCAGGTGTGG + Intronic
1166195439 19:41202808-41202830 GAGAGAGAGAAGGCCAGGTACGG + Intronic
1166195850 19:41205505-41205527 GAAAGAGAGGAAGACAGGAAGGG - Intronic
1166827872 19:45620789-45620811 GGGAGGGAGGAGGCCAGGAAGGG + Intronic
1167211399 19:48136129-48136151 GGGAGAGAGCAGGCCAGGGAAGG + Intronic
1167284868 19:48593259-48593281 GAGAGAGAGAAGGCCAGGTGTGG + Intronic
1167338814 19:48903096-48903118 AAAAGAGAGAAGGCCAGGCATGG - Intronic
1167499576 19:49837582-49837604 GCCAGACAGGAGGCCAGGAAAGG + Intronic
1167615009 19:50528029-50528051 GAGAGAGAGAGGGCCAGGCACGG - Intronic
1167641139 19:50682352-50682374 GATAGAAAACAGGCCAGGCTGGG - Intronic
1168015370 19:53568693-53568715 GACAGGGAGCTGGCCAGAAATGG + Intronic
1168156661 19:54477062-54477084 GAGAGATTGGAGGCCAGGAAAGG + Intergenic
1168584213 19:57579455-57579477 GACAGATAGCAGGCCCTGAAAGG - Intronic
1168587097 19:57602497-57602519 TATTAATAGCAGGCCAGGAAGGG + Intronic
1168626441 19:57921914-57921936 GATACAGGGCAGTCCAGGAGCGG + Exonic
925505085 2:4553609-4553631 GAGAGAGAGCCGTCAAGGAAAGG - Intergenic
926349052 2:11978701-11978723 GATAGAGTCCTGCCCAGGAAAGG + Intergenic
926437751 2:12854647-12854669 TAAAGAGAGCAGGCAAGGCAGGG + Intergenic
927183971 2:20468850-20468872 GAGATAGAGGAGGTCAGGAAAGG - Intergenic
927699220 2:25257457-25257479 GAGAGAGAGAATGACAGGAAGGG - Intronic
929779563 2:44949157-44949179 GAGAGTGAGCAGGCCAGAAGGGG - Intergenic
930126623 2:47803206-47803228 GATAGAGCAGAGGCCAGGCACGG - Intronic
930822983 2:55666412-55666434 GATAATGAACAGGCCAGGCATGG - Intronic
930824883 2:55686922-55686944 GATTGAGACCAGGCCAGGCGCGG + Intronic
931892483 2:66689237-66689259 GAAAAAGAGCAGGTCAGAAATGG + Intergenic
932235780 2:70120088-70120110 GCAAGAGAACAGGCCAGGCATGG + Intergenic
933531727 2:83518755-83518777 GAGCAACAGCAGGCCAGGAAAGG - Intergenic
934530630 2:95085574-95085596 GATAGGGAGCAGGCCATGTTAGG - Intergenic
935124910 2:100214685-100214707 GAGAGAGAGAAGCCCAGGGATGG - Intergenic
935717257 2:105950231-105950253 TATAGAAAGCAGGCCGGGCATGG + Intergenic
936955597 2:118019254-118019276 GACTGAGAGCAGGACTGGAAGGG - Intergenic
937226026 2:120369220-120369242 GATTGACAGGAGGCCAGAAAGGG + Intergenic
937695902 2:124808313-124808335 GACATAAAGCAGGCCAGGCACGG + Intronic
937815211 2:126243740-126243762 GACAAAGAGCAAGGCAGGAAAGG - Intergenic
937973645 2:127567913-127567935 GATAGGGGGCAGGCCAGGCACGG + Intronic
938006863 2:127794207-127794229 GAAAGAAAGCCGGCCAGGCACGG + Intronic
938120879 2:128632265-128632287 GTGAGAGAGCAGGCCTGGGAAGG - Intergenic
938812068 2:134862928-134862950 GACAGAGAGGAGGACAGGCAGGG + Intronic
939145557 2:138410503-138410525 GATGGAGAGATGGCCAGGCACGG - Intergenic
940065824 2:149627669-149627691 GACAGAGAGCATGCAAGAAAGGG - Intergenic
941390506 2:164907553-164907575 AAGACAGAGGAGGCCAGGAACGG - Intronic
941473019 2:165913314-165913336 AATAGAGATGAGGCCAGGCACGG - Intronic
941510605 2:166403898-166403920 GATGGAGAGCAGGAGAAGAAAGG + Exonic
944053993 2:195503974-195503996 AATAAAAAGCAGGCCAGGCACGG + Intergenic
945284060 2:208064779-208064801 GACACAGAGCAGGTGAGGAAGGG + Intergenic
945686714 2:212979925-212979947 GAAGTAGAGCAGGTCAGGAAAGG + Intergenic
946357052 2:219193885-219193907 TAAATAAAGCAGGCCAGGAATGG + Intergenic
948209273 2:236179898-236179920 GAAAGGGACCAGCCCAGGAAGGG - Intergenic
948961419 2:241341482-241341504 GATGGATAGTAGACCAGGAAAGG + Intronic
1168872802 20:1145488-1145510 GACAGAGAGTAGGGCAGAAAGGG + Intronic
1169397994 20:5252351-5252373 AATAAAGAGAAGGCCAGGCATGG - Intergenic
1169901528 20:10557654-10557676 AATGGAGAACAGGCCTGGAATGG - Intronic
1170200755 20:13741165-13741187 GATAGAGAGTTGGCAGGGAATGG - Intronic
1170744506 20:19087169-19087191 GATAAAAAACAGGCCAGGCATGG - Intergenic
1172003382 20:31799607-31799629 AAAAGAAAGAAGGCCAGGAATGG + Intronic
1172225325 20:33301719-33301741 GATAGTGAGTAGTCCAGGGATGG + Intronic
1172447270 20:34999763-34999785 GATACAGAGCAGGCAGGGTAGGG - Intronic
1173393235 20:42654034-42654056 GAAAGGGAGCAGGACAGGACAGG + Intronic
1173524016 20:43718421-43718443 GATAGAAACCAGGCCAGGTGTGG + Intergenic
1173604088 20:44317657-44317679 AATAAAAAGCAGGCCAGGAGCGG + Intergenic
1173686779 20:44929502-44929524 GATATACAGCAGGCCAGGCATGG + Intronic
1174228844 20:49027404-49027426 AATGGAGAGCAGGCCAGGCAAGG + Intronic
1174538692 20:51272836-51272858 GCTAGAAAGCAGATCAGGAAAGG + Intergenic
1177416474 21:20799699-20799721 GACGGAGAGTAGTCCAGGAAAGG - Intergenic
1177986302 21:27979095-27979117 TATATATATCAGGCCAGGAATGG - Intergenic
1178900181 21:36592302-36592324 GAGAGAGAGAGGGCCAGGAGAGG - Intergenic
1180864048 22:19105710-19105732 GACAGAGAGCAGACCTGGGAGGG + Intronic
1182034017 22:27183500-27183522 GAAAGAGGGCAGCCCAGGAAGGG - Intergenic
1183559514 22:38560100-38560122 GATAAAAATAAGGCCAGGAAAGG + Intronic
1184884107 22:47331785-47331807 GAGAGAGAGCCGGGCTGGAATGG - Intergenic
950575248 3:13828318-13828340 AATAGAGAGGGGGCAAGGAAGGG + Intronic
950634947 3:14308003-14308025 GATGGAGACCAGGCCAGCACGGG - Intergenic
951312967 3:21151975-21151997 GAGAAAGAGCATTCCAGGAAGGG - Intergenic
951390639 3:22099352-22099374 GAAAGGGAGCAGACCAGGTATGG + Intronic
951583926 3:24195860-24195882 GTTGGAGAGCTGGTCAGGAAAGG - Intronic
953652112 3:44816146-44816168 GATAGAGATATGGCAAGGAAAGG - Intronic
953662382 3:44900630-44900652 GTTAGTGTGCAGGCCAGGAGGGG + Intronic
953721755 3:45362236-45362258 GATAAAGAGGAGGGCAGGCAGGG - Intergenic
953892683 3:46765358-46765380 AATATAGACCAGGCCAGGCATGG + Intronic
954359983 3:50116615-50116637 CATAGATAGTAGGGCAGGAAGGG - Intronic
955106511 3:55903944-55903966 AACAGAGGGCAGCCCAGGAAGGG + Intronic
955668394 3:61375243-61375265 GAAATAGAGCAAGCCAGCAAGGG - Intergenic
955863238 3:63354986-63355008 GTCCCAGAGCAGGCCAGGAATGG + Intronic
956087603 3:65629138-65629160 GATAGAGATCAGTCCAAGCAGGG - Intronic
956111090 3:65870509-65870531 GAAAGAGAGCAGGGAAGGAGGGG + Intronic
956272394 3:67461920-67461942 GGTAGAGATCATGCCAGCAAGGG + Intronic
956346441 3:68284635-68284657 AAAAAAGAGCAGGCCAGGCATGG + Intronic
956638043 3:71385993-71386015 GAGAGAGGGCAGGCTGGGAAGGG - Intronic
956771757 3:72532637-72532659 GATAGAGAGGAGGCAGGGGATGG - Intergenic
957334218 3:78806262-78806284 TAGAGAGAGCAGACCAGGCAAGG - Intronic
959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG + Intergenic
959786825 3:110309406-110309428 GATAGAGAGAAGACTAAGAAAGG + Intergenic
961751215 3:129095896-129095918 GATGGATACCAGGCCAGGTAGGG + Intronic
961953743 3:130778359-130778381 GATAGATTCCAGGCCAGGCATGG + Intergenic
962169732 3:133088245-133088267 GATTGACAGGAGGGCAGGAAAGG + Intronic
962645022 3:137429823-137429845 GAAAAAGACCAGTCCAGGAAAGG + Intergenic
964826126 3:160829882-160829904 GTTAGAGAACAGGCCAGGAAAGG - Intronic
966140700 3:176752665-176752687 GAAAGAGAGCAGGGAAGGGAAGG + Intergenic
968192374 3:196678322-196678344 GATACAGAGCAAAACAGGAAAGG - Intronic
968303305 3:197632030-197632052 GATACTTAGCAGACCAGGAAAGG - Intergenic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968365257 3:198180224-198180246 GAAATAGAGCTGGCCAGGCATGG - Intergenic
968887908 4:3345310-3345332 GAGCCAGAGAAGGCCAGGAAGGG - Intronic
969402144 4:6962697-6962719 GGGAGAGAGCAGGCAAGGAGTGG - Intronic
970323957 4:14903759-14903781 GACAGAGAGATGGGCAGGAAAGG - Intergenic
971522043 4:27566085-27566107 GTTAGAAGGCAGGTCAGGAATGG + Intergenic
971837782 4:31791244-31791266 GGTGGAGAGCAGGGCAGGGAGGG - Intergenic
973289649 4:48458043-48458065 GAATGAGAGCTGGCCAGGCATGG + Intergenic
975049181 4:69838725-69838747 GATAGAGAGCAGGACATAGAAGG + Intronic
975876700 4:78848086-78848108 AAAAGGGAGGAGGCCAGGAAAGG - Intronic
976473653 4:85457989-85458011 GATGGTGAGGAAGCCAGGAACGG - Intergenic
976602419 4:86950106-86950128 GAAAGGGAGCAGGGCAGGGATGG + Intronic
977573651 4:98655882-98655904 GGCAGAGAGCAGGATAGGAAAGG + Intronic
978151776 4:105444655-105444677 GAAAGAGAGAAGGGGAGGAACGG - Intronic
978230594 4:106392805-106392827 ATTAGAGTGCAGGGCAGGAATGG - Intergenic
978870059 4:113565190-113565212 GAAAGAGAACAGGCAAGGTAGGG + Intronic
979092815 4:116508047-116508069 GAAACAGAGGAGGCCAGGCATGG - Intergenic
979254292 4:118595382-118595404 GAAACAGAGCTGGCCAGGCATGG - Intergenic
979334666 4:119450655-119450677 GAAATAGAGCTGGCCAGGCATGG + Intergenic
979384618 4:120049903-120049925 GATAGAGACCAGGCTAAGCAGGG - Intergenic
980826234 4:138076865-138076887 AAAAGAGAGCATACCAGGAATGG - Intergenic
980938361 4:139247979-139248001 GATAGAAATCAGGCCAGGCTTGG - Intergenic
981010606 4:139921369-139921391 GATAGTGAGCAGCTCAGGAGAGG - Intronic
981786586 4:148486207-148486229 TATATAGATCAGGCCAGGCATGG - Intergenic
981898840 4:149837130-149837152 GAAAGAGAGAAGGAAAGGAAAGG + Intergenic
982237863 4:153268794-153268816 GTTAGGGATCATGCCAGGAAAGG - Intronic
984615228 4:181889285-181889307 GCGAGAGAGCAGGCTGGGAACGG - Intergenic
986028438 5:3872473-3872495 GATACAGAGCAGGCAGGGCACGG + Intergenic
986696172 5:10356684-10356706 GACAGAGAACCGGCCAGGAACGG - Intronic
986918052 5:12648462-12648484 GCTAGACAGCAGGCATGGAAAGG + Intergenic
987235293 5:15936310-15936332 TATAGAGACCAAGACAGGAAAGG + Intronic
987376003 5:17235550-17235572 CATAAAGAGCAGGCCAGGCGTGG - Intronic
988270749 5:29013456-29013478 GATAAAGAGGAGGTCTGGAAGGG - Intergenic
988961360 5:36374700-36374722 GTCAGAGACCAGGCCAGGCATGG + Intergenic
989084911 5:37665922-37665944 GATAGAGAGGTGGTAAGGAAGGG - Intronic
989567019 5:42910859-42910881 AATACAGAGCAACCCAGGAAGGG - Intergenic
990430407 5:55729177-55729199 GAGAGAGAGAAAGCCAGGAGCGG - Intronic
990461075 5:56031820-56031842 GACAGAAAGCAGGCCAGGCACGG + Intergenic
990729753 5:58795475-58795497 GTTACACAGCAGGCCAGGATGGG - Intronic
991145239 5:63295230-63295252 GATAAAGACGATGCCAGGAAAGG + Intergenic
991348278 5:65693277-65693299 GAGAGAGAGCAAGGAAGGAAGGG + Intronic
992026425 5:72674093-72674115 GATAGATATCAGACTAGGAAGGG - Intergenic
992079153 5:73217773-73217795 GATAAGGACCAGGCCAGGGATGG - Intergenic
992826215 5:80552702-80552724 CTTAAAGAGAAGGCCAGGAAAGG - Intergenic
993352950 5:86872499-86872521 GGTAGAGAGAAGACCAGGTAAGG - Intergenic
994704172 5:103180557-103180579 GTTAGAGAGCAAGCCGGGCATGG + Intronic
994885867 5:105561032-105561054 GAGAGAGAGACAGCCAGGAAGGG + Intergenic
996031725 5:118712793-118712815 GATAGAGAACAGGCTGGGCATGG + Intergenic
997234640 5:132265750-132265772 GTGAGAAGGCAGGCCAGGAAGGG - Intronic
998134907 5:139669425-139669447 GAGAGAGGGTAGGTCAGGAAGGG + Intronic
998350232 5:141495436-141495458 GACAGAGAGCAGGACAAGTAGGG - Intronic
999116446 5:149168302-149168324 GGTAATGAGTAGGCCAGGAAGGG + Intronic
999183742 5:149690147-149690169 AAAAGAGAGCAGGCCTGGGATGG + Intergenic
999186599 5:149715284-149715306 GAATGAGAGCAGGCCACAAAGGG + Intergenic
999533399 5:152488202-152488224 GATATAGAGTAGGCCAGGCGTGG + Intergenic
999950100 5:156639803-156639825 GGTAGAAAGAAGACCAGGAATGG - Intronic
1000119279 5:158181034-158181056 TATAGAGAGGGGGCCAGGCATGG + Intergenic
1001094346 5:168764707-168764729 GAGAGAGAGCAGAGAAGGAAAGG - Intronic
1001631599 5:173179491-173179513 CAGAGATAGCAGGGCAGGAATGG - Intergenic
1001795170 5:174496061-174496083 AATAGAGAGTAGGACAGCAATGG - Intergenic
1001838733 5:174854855-174854877 GCTGCAGAGCAGGCCAGGCATGG - Intergenic
1002041355 5:176516791-176516813 GATACAGAAGAGGCCAGGCATGG - Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002469872 5:179428840-179428862 GACAGAGGGCAGCCCAGGCAGGG + Intergenic
1002521509 5:179795402-179795424 GACACAGGGCAGGCCAGGGATGG + Intronic
1002867170 6:1131703-1131725 GATAGAGAGGAGGAGAGGGAAGG - Intergenic
1002953955 6:1843475-1843497 TGTAAGGAGCAGGCCAGGAATGG + Intronic
1003840295 6:10112940-10112962 GAAGGAGAGGAGACCAGGAAAGG - Intronic
1004000536 6:11593069-11593091 ATTAGAGGGCAGGCAAGGAATGG + Intergenic
1004151696 6:13126306-13126328 GAGAAAGAGAAGGGCAGGAAAGG + Intronic
1004604002 6:17176866-17176888 GATAAAGACCAGGCCAGGCATGG - Intergenic
1005997988 6:30943080-30943102 GAGAGAGGCCAGGGCAGGAAGGG + Intronic
1006349136 6:33508149-33508171 GTTTGAAAGCAGGCCAGGCACGG + Intergenic
1006389082 6:33748091-33748113 CATATGGAGCAGCCCAGGAAAGG - Intergenic
1006620092 6:35357825-35357847 AATAGGCAGCAGGCCAGGCATGG - Intronic
1007166876 6:39834799-39834821 GATGGAGGGCAGGGCAGGGAAGG + Intronic
1007461381 6:42021679-42021701 GATAAAGGGCATTCCAGGAAGGG + Intronic
1007801567 6:44398221-44398243 AATAGAGAGGTGGCCAAGAATGG - Intronic
1007895752 6:45355958-45355980 AATAGAGAGAAAGCCATGAAAGG + Intronic
1008345217 6:50418451-50418473 GACAGAGAGCAGTGCATGAAGGG + Intergenic
1008856587 6:56095549-56095571 GATAGAGGCCAAACCAGGAAGGG - Intronic
1009966239 6:70581897-70581919 TAAAGAAAGCATGCCAGGAATGG - Intronic
1011174626 6:84546342-84546364 GATAAAGAGCAGGCTATTAATGG + Intergenic
1012274987 6:97262352-97262374 AAAAGATAGCAGGCCAGGCATGG + Intronic
1012817283 6:104040121-104040143 GAAAGAGAGAAGGACAGGCATGG + Intergenic
1012889612 6:104883341-104883363 GACAGAAAGTAGGCCAGGCATGG - Intergenic
1013522010 6:110942069-110942091 GAAAGAGAGATGGCCAGGCAAGG - Intergenic
1014249799 6:119103635-119103657 GAGAGAGAGGAGGCCAGGCACGG + Intronic
1014268999 6:119314787-119314809 GATGTAGGGCAGGCAAGGAAAGG - Intronic
1014699753 6:124669917-124669939 GATGGAGAGGAGGACAGAAAGGG - Intronic
1015039991 6:128704610-128704632 GAGAGAGAGAATGCCAGCAAGGG - Intergenic
1015131903 6:129820617-129820639 TGTAGAGAGAAGGCAAGGAAGGG + Intergenic
1015516433 6:134087160-134087182 GCTAGAGGGCAGGATAGGAAGGG - Intergenic
1016621306 6:146111678-146111700 AATAGAGAGAAGGCCAGTATGGG + Intronic
1016869910 6:148806816-148806838 GATAGAGAGCAAGAGAGGGAGGG + Intronic
1017538941 6:155380111-155380133 CACAGAGAACAGGCCAGGTATGG + Intergenic
1017577584 6:155822304-155822326 GACAGACAGGAGGCCAGAAAGGG - Intergenic
1017849773 6:158294999-158295021 GAAAGAGAGGAAGCCAGGCAAGG - Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1018188409 6:161287773-161287795 GACAGAGAGCAGGCAGGGCAGGG + Intergenic
1018315419 6:162552216-162552238 GACAGAGACCAGGCCAGTCATGG + Intronic
1018581955 6:165315447-165315469 TATAGAGAACAGGCCAAGTACGG - Intergenic
1018786137 6:167109362-167109384 AATAAAGACTAGGCCAGGAACGG - Intergenic
1018980933 6:168601293-168601315 GGTGGAGCGCTGGCCAGGAAGGG - Intronic
1019250935 7:10680-10702 GAAATAGAGCTGGCCAGGCATGG + Intergenic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019517662 7:1446922-1446944 GATGGAGAACTGGCCAGGAGAGG + Intronic
1020063495 7:5169959-5169981 GGTCAAGAGCAGGCCAGGTATGG + Intergenic
1020258357 7:6515485-6515507 CATATAGAGCAGGCCAGGCATGG + Intronic
1021116001 7:16747382-16747404 GAGAGAGAGGAGGGAAGGAAGGG - Intergenic
1021303126 7:18996985-18997007 GATAGAGGGCAGAAAAGGAAAGG - Intronic
1021339348 7:19444236-19444258 GAGAGAGAGAATGCCAGCAAGGG - Intergenic
1022386869 7:29908618-29908640 GATAGATATCAGGCCAGGCATGG + Intronic
1023125297 7:36949144-36949166 GTGAGTGAGCAGGCCAGGCATGG - Intronic
1023477078 7:40592457-40592479 GGTAGAGAGCATGCAGGGAAGGG + Intronic
1023696474 7:42852936-42852958 GAAAGAGAGAAGACAAGGAAAGG + Intergenic
1024069389 7:45773033-45773055 GAAATAGAGCTGGCCAGGCATGG - Intergenic
1024143030 7:46481066-46481088 GAGAGAAGGCAGCCCAGGAAGGG - Intergenic
1025930182 7:65987163-65987185 GAAACAGATCAGGCCAGGCATGG - Intergenic
1026181990 7:68049620-68049642 GACACAGAGCTGGCCAGGCACGG - Intergenic
1027135688 7:75622404-75622426 GAGAGACAGGAGGCCAGGTACGG + Intronic
1028098623 7:86793243-86793265 CACAGAGCACAGGCCAGGAAGGG + Intronic
1029222978 7:99004895-99004917 GAGGGAGAGCTGGCCAGGACAGG - Intronic
1029466308 7:100727271-100727293 CTTCGAGTGCAGGCCAGGAAAGG + Intergenic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1029870336 7:103684385-103684407 GATAGAAAGCAAGCAAGGACCGG - Intronic
1030185799 7:106760475-106760497 CATGGAGAGCAGGCCCGAAAAGG - Intergenic
1031712873 7:125071224-125071246 GATAGAGAGCATTCCAGGTCTGG - Intergenic
1031939902 7:127777518-127777540 GATGGAGACAAGGTCAGGAATGG + Intronic
1032046781 7:128617337-128617359 GAAATAGAGCTGGCCAGGCATGG - Intergenic
1032098303 7:128951359-128951381 GAAAGGAAGCAGGCCAGGAGAGG - Intergenic
1032727484 7:134604411-134604433 GAGAGAGAGAAGGCCGGGCACGG + Intergenic
1032742600 7:134753832-134753854 GAGTCAGAGCAGGCCAGGGAGGG - Intronic
1032962572 7:137053816-137053838 GAGAGAAAGTAGGCCAGGCATGG - Intergenic
1033589947 7:142800944-142800966 GTGAGAGAGAAGGCCGGGAAAGG - Intergenic
1034422802 7:150998190-150998212 GTCAGAGAGCAGGGCAGGAAGGG + Intronic
1035992749 8:4510719-4510741 GGAAGAGAGGAGGCAAGGAAGGG - Intronic
1036994830 8:13643490-13643512 GATAGACAATAGGCCAGGCACGG + Intergenic
1037094071 8:14962067-14962089 GACAGAAAGAAGGACAGGAAGGG + Intronic
1037101222 8:15049545-15049567 GATTTAGAGAAGGCCAGGAGTGG + Intronic
1037371535 8:18184333-18184355 GATAGAGAGCAGCCCACGGAGGG + Intronic
1038226386 8:25662199-25662221 GATAGAGAGGAGTCGAGAAAAGG - Intergenic
1038228422 8:25678287-25678309 GAGAGAGAGAAGGAAAGGAAAGG - Intergenic
1038820988 8:30951576-30951598 GAAAGGTAGCAGGCCAGGCATGG - Intergenic
1038925435 8:32134112-32134134 GACAGTGAGCAGGGCAGAAAAGG - Intronic
1039466145 8:37786764-37786786 GAGAGAGAGCAGGAGAGGAAAGG + Intronic
1040696629 8:50007296-50007318 AAGAGAAAGCAGGCCAGGTAGGG - Intronic
1040942100 8:52844345-52844367 GATGGCGAGGAGGCCAGGCACGG + Intergenic
1041164861 8:55081305-55081327 GATATACAGCAGGACAGGGAAGG + Intergenic
1041310545 8:56511722-56511744 GGGTGAGAGCAGGCCAGAAATGG + Intergenic
1042260702 8:66856355-66856377 GAGTGAGAGCGGGCCAGGCACGG - Intronic
1042972246 8:74422443-74422465 GAAAGAGAGGAGGGAAGGAAGGG - Intronic
1043691411 8:83157838-83157860 AATAGAGAGTAGGCCAGGCATGG - Intergenic
1043859151 8:85295759-85295781 GAGAGAGAACAGACCAGAAAGGG - Intergenic
1043960542 8:86413114-86413136 GATGGAGAGCTGGCCAGGCATGG - Intronic
1044428809 8:92084806-92084828 GAGAGAGAGAGGTCCAGGAAAGG + Intronic
1044834775 8:96285405-96285427 GGTAAAGAGCAGGGCATGAAGGG + Intronic
1044927393 8:97221223-97221245 GACAGGGACCAGGCCACGAAGGG + Intergenic
1045044018 8:98257284-98257306 GACAGATAGCAGGCCCTGAAAGG + Intronic
1045379855 8:101612278-101612300 GTAAGAGAGAAGGCCAGGCATGG - Intronic
1045777854 8:105826901-105826923 GCTAGAGAACAGGCAGGGAAGGG - Intergenic
1046020569 8:108659855-108659877 GATGTAGACCAGTCCAGGAACGG - Intronic
1046836868 8:118811421-118811443 GAGAGAGAGCAAGCAAAGAAGGG + Intergenic
1046929623 8:119829136-119829158 GGTAGAGAGCAGATCAGGAGGGG - Intronic
1047186996 8:122642633-122642655 GAGAGAGAGCAGGCCAGACTGGG - Intergenic
1047346574 8:124034600-124034622 GAGAGAGAGCAGAGCAGTAAGGG + Intronic
1047616431 8:126566019-126566041 GATAGATAACAGAGCAGGAAAGG - Intergenic
1047746132 8:127846351-127846373 GAGAGAGAGGAGACCAGGAAAGG - Intergenic
1048165659 8:132059287-132059309 GACAGAGAGCAGGGGAGGGAGGG - Intronic
1048613402 8:136048588-136048610 AAGACAGAGAAGGCCAGGAAAGG - Intergenic
1049286491 8:141778189-141778211 GGTGGAGAGCAGGCCTGGCATGG + Intergenic
1049704037 8:144030647-144030669 AATAAACAGCAGGCCAGGCATGG - Intronic
1049792464 8:144478273-144478295 GAGAGGGAGGAGGCCGGGAAGGG + Intronic
1051661146 9:19428067-19428089 GAGAGAGAGAAGGAAAGGAAAGG - Intronic
1051777398 9:20650853-20650875 AATTGAGAGTAGGCCAGGCACGG - Intergenic
1051838261 9:21364936-21364958 GATAAAGAGCTTGCCAGTAAAGG - Intergenic
1052850834 9:33377513-33377535 GACAGGGAGCAGGCAAGGTAGGG - Intergenic
1053135601 9:35648737-35648759 GAGAGAGTGAAGGCCAGGCACGG + Intergenic
1054830560 9:69620388-69620410 GACAGAGTGCCGGCCAGGCATGG + Intronic
1055286567 9:74734920-74734942 AATAGAGAATAGGCCAGGCACGG + Intronic
1055508435 9:76971136-76971158 GGAAGAGAACAGGTCAGGAAGGG - Intergenic
1055892809 9:81141355-81141377 AAAAAAGAACAGGCCAGGAATGG + Intergenic
1056445733 9:86664926-86664948 GAGAGGCAGCAGGCCTGGAATGG + Intergenic
1056554809 9:87679419-87679441 GTTAGGGAGCAGGGCAGGAGTGG + Intronic
1056733476 9:89185066-89185088 GACAGAGAGGAGGCCAGAGAGGG + Intergenic
1057269914 9:93644925-93644947 AGTAGGGAGCAGGCCAGGACAGG + Intronic
1057746575 9:97757103-97757125 GACACAGAGCAGGACAGAAAAGG - Intergenic
1058345543 9:103956786-103956808 GGTAGAGAGTAGATCAGGAAGGG - Intergenic
1058359798 9:104131242-104131264 GAGAAAGAGCATTCCAGGAAGGG + Intronic
1058539680 9:105998836-105998858 GACACAGAGCAGGCCAGGGATGG - Intergenic
1058554747 9:106155026-106155048 CATAGAGAGCAGGCCAAGAGAGG - Intergenic
1058799888 9:108535227-108535249 AATAGAGAGCAGGGCAAAAAAGG + Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1059419996 9:114184925-114184947 GTCCCAGAGCAGGCCAGGAAGGG - Intronic
1060112970 9:120919651-120919673 GTTACAGAGGAGGGCAGGAACGG - Intronic
1060151003 9:121288216-121288238 GACAGAAAGCAGGCCAGGTGAGG - Intronic
1060155074 9:121313903-121313925 GATAGAGAGATGGAGAGGAAGGG - Intronic
1060457271 9:123810419-123810441 GAGAAAGAAAAGGCCAGGAATGG + Intronic
1060746673 9:126139449-126139471 GAGAGAGAGCATGCCAGAGATGG - Intergenic
1060798145 9:126526526-126526548 GATGGAGAGCAGGCCAGAGCCGG + Intergenic
1061264433 9:129497125-129497147 GAAAGAGAGCAGGAGAGGAGGGG + Intergenic
1061432958 9:130542949-130542971 GAGAGAGAGCAGGGCAGGGGAGG + Intergenic
1061540358 9:131275069-131275091 GTCAGGAAGCAGGCCAGGAAAGG + Intronic
1061681333 9:132243845-132243867 CAGAGAGAGGAGGCCAGGAGGGG - Exonic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1062749626 9:138243089-138243111 GAAATAGAGCTGGCCAGGCATGG - Intergenic
1203441883 Un_GL000219v1:16395-16417 GAGAGAGAGTGGGCCAGAAAAGG - Intergenic
1203360763 Un_KI270442v1:217959-217981 GAGAGTGAGCAGGCCAGGCCGGG + Intergenic
1203512691 Un_KI270741v1:135304-135326 GAGAGAGAGTGGGCCAGAAAAGG - Intergenic
1186177612 X:6941617-6941639 AATAGAAACCAGGCCAGGCATGG - Intergenic
1186418393 X:9403302-9403324 GGTACTGAGCAGGCCAGGATGGG + Intergenic
1186904676 X:14098514-14098536 TAAAGAGTGCAGGCCAGGCACGG - Intergenic
1187037680 X:15559218-15559240 CATAGTGATCAGGCCAGAAATGG - Intergenic
1187110352 X:16292390-16292412 AAGAGAGAGCAGGCAATGAAGGG + Intergenic
1187239646 X:17501077-17501099 GAAAGGGATCAGGCCAGGCAGGG + Intronic
1189202121 X:39205396-39205418 GAAACAGAGCAGGGCATGAAGGG + Intergenic
1189234547 X:39477300-39477322 GAATGAAAGTAGGCCAGGAACGG + Intergenic
1189246986 X:39570871-39570893 GTTAGAGAGCAGGCTAAGGAGGG - Intergenic
1189321652 X:40090737-40090759 GAGAGAGAGCAAGGCGGGAAGGG + Intronic
1189631396 X:42957750-42957772 GACAAAGAGCAGGCTGGGAAAGG - Intergenic
1189795417 X:44641579-44641601 GGTAGAGAGCAGGCAGAGAAGGG - Intergenic
1190079754 X:47347096-47347118 GAGAGACACCAGGCCAGGCACGG - Intergenic
1190549603 X:51565313-51565335 GTTAAAAAGCAGGCCAGGCATGG + Intergenic
1190713283 X:53084474-53084496 GAGGGAGGGAAGGCCAGGAAGGG - Intronic
1190753959 X:53384655-53384677 AAGAGAAAGCAAGCCAGGAATGG + Intronic
1191044535 X:56121308-56121330 GATGGAGAGAAGGGCTGGAAAGG + Intergenic
1192317699 X:70065711-70065733 GGTGGAGAGAAGGGCAGGAAAGG + Intergenic
1192451717 X:71248969-71248991 GGTAGAGAGAAGGCCAGCAGGGG + Intronic
1192526271 X:71847338-71847360 GAGGTAGAACAGGCCAGGAAAGG - Intergenic
1193797723 X:85897402-85897424 GAGAGAGAGCAGGCAATAAAGGG + Intronic
1195584905 X:106553683-106553705 GATCAAGAGTAGGCCAGGCACGG + Intergenic
1196751939 X:119126159-119126181 GCTAGAAAGCAGGACAGGATGGG - Intronic
1199034287 X:143032598-143032620 GAGAGAGAGCAATCCATGAACGG + Intronic
1199471413 X:148199712-148199734 GGCAGAGACCAGGCCATGAAGGG - Intergenic
1201279440 Y:12328449-12328471 GCTAGAGATCAGGGCAGGAATGG + Intergenic
1201493697 Y:14570363-14570385 GAGAGACAGCAGGTCAGGAAAGG + Intronic
1202115132 Y:21464985-21465007 AACAGAGAGGAGGCCAGGCAAGG - Intergenic
1202346449 Y:23933055-23933077 AATAGAGATCATGCCAGGCATGG - Intergenic
1202524322 Y:25737038-25737060 AATAGAGATCATGCCAGGCATGG + Intergenic