ID: 924157887

View in Genome Browser
Species Human (GRCh38)
Location 1:241199941-241199963
Sequence CTTCATCTGCAAAATGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 1, 2: 13, 3: 98, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924157883_924157887 15 Left 924157883 1:241199903-241199925 CCTTTGACAGGTCATATAGCATG 0: 1
1: 0
2: 0
3: 10
4: 255
Right 924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG 0: 1
1: 1
2: 13
3: 98
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924157887 Original CRISPR CTTCATCTGCAAAATGTGGG TGG Intronic
900508275 1:3041613-3041635 CTCCATCTGCAAAAAGTGGTAGG + Intergenic
900869873 1:5294501-5294523 CTCCAGCTGCACAATGTGTGAGG + Intergenic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901895224 1:12306225-12306247 CTTCATCTGTGAAATCGGGGCGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903366965 1:22811097-22811119 CTTCATTTGTAAAATGAGAGGGG + Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903853994 1:26325112-26325134 CCCCATCTGTAAAATGTGAGGGG + Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904341038 1:29834787-29834809 CTTTATCTTTAAAATGGGGGAGG + Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905913049 1:41666936-41666958 CTGCATGTGCAAAATGTGCTTGG - Intronic
905971151 1:42143498-42143520 TTTCATCAGCAGAATGTGAGAGG - Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907700852 1:56786623-56786645 CTTGAGCTGTAAAATGTGAGCGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
908888942 1:68820790-68820812 TTTCTTCTGCAAAATCTGGTGGG + Intergenic
909606117 1:77509974-77509996 CTTCAGTTACAAAATGGGGGTGG - Intronic
909795279 1:79727773-79727795 CTTCATCTATCAAATGTGGTGGG - Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911037972 1:93570137-93570159 CTTCATCGGGAATTTGTGGGGGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912725244 1:112053485-112053507 CCTCATCTATAAAATGTGGTAGG + Intergenic
913015566 1:114730528-114730550 CTTCATCTGCAATATGGAGCTGG + Exonic
915270570 1:154750549-154750571 CTTCATCTGGGAAGGGTGGGGGG + Intronic
915566377 1:156715683-156715705 CTTCCTCTGCACAATGTCTGGGG - Intergenic
915848734 1:159298149-159298171 CTTCATCGGCAAAGTGTGAGTGG + Intronic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
917522450 1:175759503-175759525 CTTCCTCTGCAACCTGTGGAGGG + Intergenic
917801195 1:178572229-178572251 CTTCACCTGTAAAATGAAGGCGG - Intergenic
918118376 1:181516441-181516463 CTTCATCTGTAAAATGGGACTGG - Intronic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
919631478 1:199964180-199964202 CTTCCTCTGTAAAATGGGTGGGG + Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921300178 1:213744579-213744601 CTTTATCTGTAAAATGGGGCTGG + Intergenic
921383457 1:214548125-214548147 CTTCATCTGCAAAATGGATCTGG - Intronic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
921639425 1:217534305-217534327 CTAAATCTTCAAAATGTGGGTGG - Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
924707539 1:246511778-246511800 TTTCATCTGGAACATGTCGGGGG + Intergenic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1065387736 10:25150060-25150082 ATTGCTCTTCAAAATGTGGGTGG - Intergenic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1068715062 10:60178904-60178926 CTTCAAATGCAAAAGGGGGGTGG + Intronic
1068779580 10:60905092-60905114 CTTCAAGTGCAAAATGTAAGAGG + Intronic
1070042109 10:72792099-72792121 CTGCCACTGCAAAATGTGTGTGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070967477 10:80538409-80538431 CCTCTTCTACAAAATGCGGGAGG + Exonic
1071124456 10:82318176-82318198 CCTCATGGGCAAAATTTGGGTGG + Intronic
1071277153 10:84065729-84065751 CTCCATCTGCAAAATGGTGGTGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072630753 10:97144901-97144923 CCTCATCTGTAAAGTGTTGGGGG - Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074059301 10:109950365-109950387 CTCCATGGGCAACATGTGGGAGG + Intronic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075247805 10:120839582-120839604 CTTCATTTACAAAATGGGGTTGG + Intergenic
1076073001 10:127507446-127507468 CTTTATCTGTAAAATGTAGTTGG - Intergenic
1076574188 10:131453162-131453184 CTTCCTCTCCTAAATGTGGGAGG - Intergenic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079837527 11:25351854-25351876 CTTCAACTGGAAAATCCGGGTGG - Intergenic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1080002665 11:27367989-27368011 CTTCATCTGCATAATCAGAGTGG + Exonic
1080572005 11:33565224-33565246 CTTCCCCTGAAAAATGTGGCAGG - Intronic
1080670375 11:34371234-34371256 CTTCATAAGCAAAATATGTGTGG - Intergenic
1081286764 11:41279826-41279848 CTTGATCTATAAAATGTGGCTGG + Intronic
1081760798 11:45575346-45575368 CTTTATCTCTAAAATGGGGGTGG - Intergenic
1081858469 11:46318456-46318478 CTTCATCTAGAAAATGGGAGTGG + Intronic
1081941185 11:46943713-46943735 CCACATCTCCAAAATGTGGGTGG + Intronic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083195503 11:61083437-61083459 CTTCATCTGCAAAGCAGGGGAGG - Intergenic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083682991 11:64359764-64359786 GGGCATTTGCAAAATGTGGGAGG - Intronic
1083739096 11:64698478-64698500 CCTCTTCTGCAAAATGAGAGGGG + Intronic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085636590 11:78163943-78163965 CTTCCTCGGCAAAATGTGCAAGG - Intergenic
1085782628 11:79423298-79423320 CTTCATCTGTACAATGGCGGGGG - Intronic
1086157127 11:83679797-83679819 CTTTATCTGTAAAATGGAGGAGG - Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1088142054 11:106629353-106629375 CTTAATCTGTCAAATGAGGGGGG - Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1088903038 11:114133211-114133233 GTCCATTTACAAAATGTGGGGGG + Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089617422 11:119702822-119702844 CTGCATCTGCCAAAGGTGTGGGG - Intronic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1090641734 11:128735071-128735093 CTTCATCAGCAAAGTGGGGGAGG + Intronic
1091099105 11:132853847-132853869 CTTCATCACCAAAATGTGCAGGG + Intronic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1092057467 12:5520011-5520033 TTTCATCTGTAAACGGTGGGTGG - Intronic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1092984594 12:13833731-13833753 CTGCATCTGTAAAATGGGGTAGG - Intronic
1093395020 12:18670531-18670553 CTTCATCTGCAAAATCTCCAGGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1094035539 12:26066480-26066502 CTTGATTTTCAAAATTTGGGTGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1096070143 12:48770770-48770792 CTTCATCTGGAAATTGTTGAAGG + Exonic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097743027 12:63267699-63267721 CTTAATCAGCAAAAAGTGAGTGG - Intergenic
1098023267 12:66176251-66176273 CTTCATCTACATAATTTGTGGGG - Intergenic
1098063553 12:66587882-66587904 TTTCCCCTTCAAAATGTGGGTGG - Intronic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098366833 12:69712298-69712320 TTTCATCTACAAAATGAGAGGGG - Intergenic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100671653 12:96819839-96819861 CTTCAACTGCAACAGGAGGGTGG - Intronic
1101378420 12:104191001-104191023 ATTGACCTCCAAAATGTGGGTGG - Intergenic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102516556 12:113452617-113452639 CTTCATCTGAAGTATGTGGGTGG - Intergenic
1102714606 12:114959445-114959467 CTTCATTTATAAAATGGGGGAGG - Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102866409 12:116378480-116378502 CTACATCTGGAAAATGGGGCTGG + Intergenic
1103139454 12:118535928-118535950 CTTCATCTGCAACATGGGTTTGG - Intergenic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103598643 12:122040116-122040138 CTCCATCTGTAAAATGCGGTTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1105720124 13:23105052-23105074 TTACATTTGCAAAATTTGGGTGG - Intergenic
1105896767 13:24723254-24723276 CTTCATCTGCAAGCTCTGGCGGG + Intergenic
1106408333 13:29493474-29493496 TCTCATCTGGAAATTGTGGGAGG + Intronic
1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG + Intergenic
1107327342 13:39258799-39258821 TTCCATTTGCACAATGTGGGTGG - Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108967330 13:56326109-56326131 GTACATCTGTAAAATGGGGGTGG + Intergenic
1109759036 13:66802527-66802549 ATTCAACTGAAAAATGTGGCAGG + Intronic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1112011683 13:95298938-95298960 CTGCATTTTCAAAATGTAGGTGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113082271 13:106532808-106532830 CTTCATCATCAGAATGGGGGGGG + Intronic
1113161348 13:107384982-107385004 CTCCATCTACAGAAAGTGGGTGG + Intronic
1113963829 13:114140508-114140530 CTTCGTCTGTAAAATGGGGCTGG + Intergenic
1114368095 14:22052267-22052289 ACAGATCTGCAAAATGTGGGAGG - Intergenic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118696071 14:68386518-68386540 CTGCATGTGCTAAATGTGGGAGG - Intronic
1119113903 14:72000473-72000495 CTTCATCTTCAAGATGGGGTTGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1120485385 14:85107184-85107206 ATTCATATGCAAAGTGTTGGTGG - Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121247683 14:92474139-92474161 CTTCATCAGCATAATATGTGGGG + Intronic
1121878222 14:97474506-97474528 TTCCATCTGCAAACTCTGGGGGG + Intergenic
1122037140 14:98957140-98957162 GTTCATCTGCAGATTGTGGGGGG + Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122198222 14:100105664-100105686 CTTCGTCTGTGAAATGTAGGTGG + Intronic
1122538956 14:102486069-102486091 CTGCATCTGCTAATTGTAGGGGG - Intronic
1123827856 15:24101453-24101475 CTACATCTGCAAAAGGACGGAGG - Intergenic
1123899608 15:24863205-24863227 CTACATCTGCAAAATGGCTGAGG - Intronic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124783308 15:32656273-32656295 CGTCATCTGGAAAAAGAGGGAGG + Intronic
1125224017 15:37373948-37373970 CTTCATCTGTAAAAAGCTGGTGG - Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1126002114 15:44220503-44220525 CTTCATTAGTAAAATGTGGGAGG + Intergenic
1126576539 15:50202651-50202673 CTTTTTCTACAAAATGTTGGAGG + Intronic
1127197929 15:56610155-56610177 TATCTTCTGCAAAATATGGGAGG - Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128177279 15:65566958-65566980 CTTCATCTACACAAGGTGGGAGG - Intronic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128702378 15:69813848-69813870 TGTTATCTGCAAAATATGGGGGG + Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132303388 15:100790081-100790103 CATCATCTGCCTACTGTGGGCGG + Intergenic
1132533534 16:466122-466144 CTTGCTCTGCACAATGTGGCTGG + Intronic
1133670447 16:8013747-8013769 CCTCTTCTCCAAAATGTAGGAGG + Intergenic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134369616 16:13610878-13610900 ATTGCTCTGCAAAATATGGGAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1134771506 16:16813233-16813255 CTTCATCTGTATAATGGTGGTGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1134819414 16:17234138-17234160 TTTCCTCTGCAAAATGGGCGTGG - Intronic
1136099156 16:27980567-27980589 CTTCATCTGTAAAATGGGTGTGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138210003 16:55155561-55155583 TTTCATCTGCAAAATGTTCTGGG + Intergenic
1138342799 16:56301880-56301902 CTTCGTCTGTAAATTGGGGGTGG - Intronic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1140316996 16:73908184-73908206 ATTACTTTGCAAAATGTGGGGGG + Intergenic
1140555534 16:75916836-75916858 CTGCATCTGTAGAATCTGGGAGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141513593 16:84528233-84528255 CCCCATCTGTAAGATGTGGGTGG + Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142928793 17:3264928-3264950 CTTCATGTGCAACATGGGGGTGG - Intergenic
1143969008 17:10778940-10778962 CTCCATATGGAAAGTGTGGGAGG + Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146292125 17:31616139-31616161 CTTCATCTTCATAATTTGGTTGG - Intergenic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147171128 17:38619575-38619597 CTTCATCTGTAAAATGGGCCTGG + Intergenic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1148553973 17:48566835-48566857 CCTCATCTGGAAAGTGTTGGGGG - Intronic
1148986659 17:51628434-51628456 CCTCCTCTGCGAAATGGGGGAGG - Intergenic
1149329132 17:55563467-55563489 ATTTATCTGTAAAATGGGGGTGG + Intergenic
1150285431 17:63951313-63951335 CTCCAGCTGTAAAATGGGGGTGG - Intronic
1152101673 17:78305162-78305184 CCTCATCTGGATGATGTGGGTGG + Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153170369 18:2309519-2309541 CTCCATCTGCAAAATGGAGCTGG - Intergenic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157165382 18:45354036-45354058 CTTCATCTGTAAAATATTGAAGG + Intronic
1157467021 18:47956059-47956081 CTTCATCCTCAAAATCAGGGTGG - Intergenic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1157866871 18:51195766-51195788 CTTTGTCTGAACAATGTGGGAGG + Intronic
1159052042 18:63429418-63429440 CTGCATCTGTAAAATGGGGGTGG + Intergenic
1161692354 19:5743724-5743746 CTGTCTCTGCAAGATGTGGGAGG + Intronic
1161692568 19:5745320-5745342 CTACATCTTCAAAATGAGGCCGG + Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1163172836 19:15544407-15544429 CTTCAGCTACAAAATGGGGGTGG + Intronic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1165126254 19:33600120-33600142 CTCCATCTGGAAACTGTGAGAGG + Intergenic
1166064547 19:40349545-40349567 CTTCATCTGCAAAATGCACACGG + Intronic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1167419196 19:49393359-49393381 CTTCCTCTGGAAAATGGGGTTGG - Intronic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168537536 19:57183782-57183804 CTTAAGCTGCCAAGTGTGGGTGG + Intergenic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925422423 2:3723797-3723819 GTTCAACTACAAAATCTGGGAGG - Intronic
926672957 2:15592223-15592245 CTTCGGCTGCAAAATCTAGGCGG + Intronic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928637451 2:33262302-33262324 TTTAATCTGCAAACTGTGGCTGG + Intronic
929349590 2:40933713-40933735 TTTCATCTGTAAGATCTGGGAGG - Intergenic
930004619 2:46886459-46886481 CCTCATCTGGAAAATGTTTGTGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931633658 2:64323034-64323056 CACCAGCTGCAAAATGGGGGTGG + Intergenic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
932461450 2:71884405-71884427 CTTCATCTGAAAACTGGAGGTGG - Intergenic
932578809 2:72980083-72980105 CCTCTTCTGCAAGAAGTGGGAGG + Intronic
934021370 2:87957143-87957165 CTTCATCTTGTAAATTTGGGTGG - Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935386382 2:102503811-102503833 CTAAATCTGCAACATGTTGGAGG - Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937228675 2:120384336-120384358 TTTCATGTGCAAAATGGGGCTGG + Intergenic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
939702060 2:145404851-145404873 CTCCAGCTGCAAAGTGTTGGTGG + Intergenic
940004620 2:148999282-148999304 CTTCATCTACAGAAAGCGGGAGG - Intronic
940633799 2:156272235-156272257 CTTCATCAGTTCAATGTGGGTGG - Intergenic
941049732 2:160719135-160719157 CTTCAAGTGCAACATGTGTGAGG + Intergenic
943037819 2:182768006-182768028 ATTCTCCTTCAAAATGTGGGGGG - Intronic
944617039 2:201471532-201471554 CCTCATCTGCGAAATGGGAGTGG - Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945832640 2:214805583-214805605 CTTCATCTGCACAAAATGAGTGG - Intronic
948565771 2:238885104-238885126 CTGCATCTGCACAATCTGGGAGG - Intronic
1169972434 20:11282823-11282845 GTTCATCTTCAAAATATAGGGGG + Intergenic
1170009913 20:11711872-11711894 CCTCATCTGTGAAATCTGGGAGG - Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1170542706 20:17405147-17405169 CCTCATCTTCAAAATGTAGGTGG - Intronic
1171092015 20:22294237-22294259 CTTCAGATGCAAAAGGTGAGAGG - Intergenic
1171891856 20:30724537-30724559 CTGCAGCTGCAAACTGTGCGTGG - Intergenic
1172114312 20:32564668-32564690 CTTCATCTGTAAAATGGGCTAGG + Intronic
1172137894 20:32699863-32699885 ATTCTTCTCCATAATGTGGGTGG + Intergenic
1172505522 20:35459213-35459235 CCTTATCTGCAAGATGAGGGGGG + Intronic
1172780344 20:37433068-37433090 GTTCATCTGCCCAATGTGAGAGG + Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1173818788 20:46007721-46007743 CTTCAACTGCAAATTGGGGCAGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174709405 20:52688968-52688990 CTGCATCTGTAAAACGGGGGGGG - Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175572385 20:60033851-60033873 TTTCCTCTGCAAACTGTGGATGG + Intronic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1176625324 21:9087438-9087460 CTGCAGCTGCAAACTGTGCGTGG + Intergenic
1176702619 21:10074281-10074303 CTTCATTTGCAAAAGGTTGTTGG - Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1178713918 21:34946188-34946210 GTTCATCTGCAAAACGTGTGAGG - Intronic
1179257380 21:39728451-39728473 CTCCCTCTGAAAAATGTAGGAGG - Intergenic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1180044039 21:45294598-45294620 CGTCATCTGGGAAACGTGGGGGG + Intergenic
1180686625 22:17672445-17672467 CTTCATTTGAAACAAGTGGGTGG + Intronic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181949392 22:26543075-26543097 CTTCAGCTGCAAAATCAGGGTGG + Intronic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183442657 22:37831961-37831983 CTGCATCTGCAGACTGAGGGAGG + Exonic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1184330339 22:43823255-43823277 CTCCATCTGCAAAGTGAGGTGGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184384835 22:44168079-44168101 CTTCATCTGTAAAATGGGCCTGG - Intronic
1184469040 22:44685114-44685136 CCTCTTCTGAAAAATGTGGGTGG + Intronic
1184628957 22:45760698-45760720 CCTCATCTGCAACATGGGAGAGG - Intronic
1184946460 22:47807593-47807615 CTTCCTTTGCAGAATGTCGGGGG + Intergenic
949144082 3:673954-673976 CTTAATATCCAAAATGTGGCAGG + Intergenic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949876251 3:8627901-8627923 CTTCATCTGTAAAATGGTGCGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950463224 3:13138085-13138107 CTCCATATGCAAAATGAGAGGGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950711022 3:14812764-14812786 CTTTATCTGAAAAATGGGGTTGG + Intergenic
951935075 3:28014164-28014186 CCTCGTCTGTGAAATGTGGGAGG - Intergenic
952227719 3:31396118-31396140 CTTCATCAGGTAAATTTGGGAGG - Intergenic
952396341 3:32923697-32923719 CTTCATCTGGCAAATATGGCTGG + Intergenic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953739001 3:45520507-45520529 CCTCATCTGTAAAATATTGGGGG - Intronic
954260393 3:49434469-49434491 CTTCATCTCAAAAATGCGGCCGG + Intergenic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
955510458 3:59675574-59675596 CTTTATCTGCAAAATGGGAGTGG - Intergenic
956336075 3:68165434-68165456 CTTCATATTCAAAAGCTGGGTGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956686105 3:71828985-71829007 CTTCATCTTTAAAATGAAGGTGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956971680 3:74533550-74533572 TTTCATCTGTAACATGGGGGTGG - Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958671549 3:97211700-97211722 CTTCAACATCAAAATTTGGGGGG + Intronic
958740063 3:98058288-98058310 TTTCATTTGCAAAATGTTAGAGG + Intergenic
960031358 3:113058113-113058135 CTTCATCTGCAAGATGGGTGGGG - Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960885135 3:122385937-122385959 CTTCATTTATAAAGTGTGGGAGG - Intronic
961846474 3:129768753-129768775 CTTCATCTGTAAAATAAAGGTGG + Intronic
962187219 3:133272728-133272750 CTTCATCAGAAAAATGCAGGAGG - Intronic
962410009 3:135132823-135132845 CATCATCTGCAAAAAGTGCCGGG + Exonic
962471088 3:135709971-135709993 CTTCATCTGTAGAATGGGTGTGG - Intergenic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
964410392 3:156391590-156391612 ATACCTCTACAAAATGTGGGAGG + Intronic
964694089 3:159487477-159487499 CTCCAACTGTGAAATGTGGGTGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG + Intergenic
967112047 3:186302408-186302430 CTTCTTCAGCAAATTGTGAGTGG - Intronic
967424409 3:189309739-189309761 CTTAATCCACAAGATGTGGGAGG - Intronic
967506422 3:190257748-190257770 CTTCCTCCGTAAAATGGGGGTGG - Intergenic
967711902 3:192718503-192718525 CTTCATCTGCAAAACAAGAGTGG - Intronic
967759399 3:193206418-193206440 ATTACTCTCCAAAATGTGGGTGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969501721 4:7557354-7557376 CTTCATCTGTAAATTGGGGTTGG + Intronic
970795976 4:19914058-19914080 CTCCATTTACAAAATGAGGGAGG + Intergenic
971295896 4:25390771-25390793 CTTCATCTGCTACATGTGTGTGG + Intronic
972284465 4:37635013-37635035 CATCATCTGCATACGGTGGGCGG - Exonic
972657649 4:41080291-41080313 CTTTGTCTGCAAAATTTGTGTGG - Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
974391752 4:61279544-61279566 CTTCATCTATAAGATGTGGTTGG + Intronic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977171114 4:93763753-93763775 CTTCATCCATAAAATGGGGGAGG + Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
981073257 4:140567512-140567534 CTCCATCTGGAGAATATGGGTGG - Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
985022846 4:185710510-185710532 TTCCATCTTCAAAATTTGGGGGG - Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
987650659 5:20736338-20736360 CTTCATCAGCAAAATGAGATGGG - Intergenic
988125930 5:27037071-27037093 CTTCTTCTGCAGAATGTAGGAGG + Intronic
988744893 5:34125123-34125145 CTTCATCAGCAAAATGAGATGGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
991984632 5:72272092-72272114 CTTGATCTTTAAAATGTGGCAGG - Intronic
991994604 5:72374896-72374918 TTTAAGCTGCAAAATTTGGGGGG + Intergenic
992155497 5:73951562-73951584 CTTGACCTGCCAAACGTGGGAGG + Intergenic
992401143 5:76412872-76412894 CCTCATCTGTAAAATGTAAGTGG + Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993208261 5:84914081-84914103 CTTTATCTTCAAAAGGTGAGGGG + Intergenic
994022066 5:95038660-95038682 TTTCATCTGTGAAATGGGGGAGG - Intronic
994798337 5:104335919-104335941 TTCCACCTGTAAAATGTGGGGGG + Intergenic
997276171 5:132593417-132593439 CTTAATTTGCAAAATATGAGGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997622764 5:135309636-135309658 CCTCATCTGTGAAATGTGAGAGG + Intronic
998246685 5:140513465-140513487 CTTGATCTGGAAAAGGTGAGTGG + Exonic
998254488 5:140574255-140574277 CCTCATCTGGAAAATGTCGGGGG - Intronic
998831872 5:146168199-146168221 CTTCATCTGGAAAATCAGGGGGG + Exonic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999860920 5:155644850-155644872 CTTCATCTGACAAATTTGGCAGG + Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000379128 5:160613183-160613205 CTTCACCTGGAAAATCAGGGTGG + Intronic
1000981642 5:167823096-167823118 CTTAGTCTGGAAAATGTGGTCGG + Intronic
1001284623 5:170413534-170413556 CTTCATCTGCAAGATGGGAATGG + Intronic
1001382834 5:171315380-171315402 CTGCATCTGTAAAATGGGCGCGG - Intergenic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001588331 5:172848667-172848689 CAGCATCTGCACACTGTGGGTGG + Intronic
1001769380 5:174281508-174281530 CTTGTTCTGCAAAATGGGGTTGG - Intergenic
1001953630 5:175833294-175833316 TCTCATCTGCAAAATCAGGGTGG - Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1004268141 6:14167455-14167477 CTTCATCTACAAATAGTGTGGGG - Intergenic
1004604308 6:17179492-17179514 CTTCAACTACAAAAGCTGGGAGG - Intergenic
1006065320 6:31457247-31457269 GTCCATCTGCAAAACCTGGGAGG - Intergenic
1006635418 6:35458064-35458086 CCTCATGTGGGAAATGTGGGAGG + Intronic
1006782864 6:36643850-36643872 CTTCATCTGTAAAACAGGGGTGG + Intergenic
1007217279 6:40250132-40250154 CTTCATCTGTGAAATGGGTGTGG + Intergenic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007856010 6:44858407-44858429 CTTCATCCGTAAAATGGAGGTGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008565498 6:52764155-52764177 CTTCATCTACACCATGTAGGGGG + Intergenic
1008794155 6:55280072-55280094 CTGCATCTGCTATTTGTGGGAGG + Intronic
1010229941 6:73525234-73525256 CTCCATCTATACAATGTGGGTGG - Intergenic
1011350850 6:86422107-86422129 CTTCATTTGCAAAATGGTGTGGG + Intergenic
1011675832 6:89732647-89732669 CTTCATGAACAAAATGGGGGAGG - Exonic
1012356787 6:98324003-98324025 CTTGAGCTGAAAAATGTGTGTGG + Intergenic
1012422731 6:99082312-99082334 TTTAATTTGCAAAATGTGAGTGG - Intergenic
1012490611 6:99779520-99779542 CTTCATCTGTAAGATTTTGGAGG + Intergenic
1013077826 6:106786903-106786925 CTTCATTTTCCAAATGTAGGAGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013465154 6:110411390-110411412 TGTCATCTCCAAATTGTGGGAGG - Intronic
1013521487 6:110937777-110937799 CTCCATCTGTAAACTGAGGGTGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1016859832 6:148706381-148706403 CTTCATCTGCAGACTGTGCTGGG + Intergenic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017641422 6:156497984-156498006 CTTCTTCTGGAAAATGACGGTGG + Intergenic
1018884139 6:167918507-167918529 GTTCATCTATAAAATGTGTGCGG + Intronic
1019577375 7:1744019-1744041 CCTCATCTGCAAAATGGACGGGG - Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021840157 7:24715887-24715909 CTTCATTTGCAGAATGAGAGAGG + Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022469653 7:30674474-30674496 GTTCATCTGCACCAGGTGGGTGG - Intronic
1024196106 7:47060592-47060614 TTCCATCTTCAAAATCTGGGTGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1024985650 7:55191363-55191385 GTTTATCTGCAAAGTGGGGGTGG - Intronic
1025214422 7:57043825-57043847 ATTCATCTTCAAAATGTCAGCGG + Intergenic
1025657533 7:63532988-63533010 ATTCATCTTCAAAATGTCAGCGG - Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030815991 7:114038336-114038358 CTTCATTTGCAAAATGTTAGTGG + Intronic
1031226928 7:119051200-119051222 ATTGATCTCCATAATGTGGGTGG + Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035859568 8:3013263-3013285 CTTAATCAGGAACATGTGGGTGG - Intronic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036915099 8:12796990-12797012 AGTCATCTGCAGGATGTGGGTGG + Intergenic
1037163797 8:15802229-15802251 CTTCATGCCCATAATGTGGGTGG - Intergenic
1039148011 8:34471671-34471693 CTTTATATGCTAAATGTAGGAGG + Intergenic
1039554460 8:38466781-38466803 CTACATCTGGAAATTGGGGGTGG + Intronic
1039823707 8:41155712-41155734 CTTCACCTGTAAAATGTTTGTGG - Intergenic
1040988893 8:53328095-53328117 CTTCATGTGCAGATTGTTGGTGG - Intergenic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1044890072 8:96825348-96825370 CTTCATATTCAAAATCTGTGTGG - Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1048182224 8:132206033-132206055 CTTCTTCTGGAAAGTGTGAGAGG - Intronic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1050150442 9:2614506-2614528 TTTCATCTGAAAAATGGGGGTGG - Intergenic
1050965694 9:11798753-11798775 CTTTATCTGAAAAAGGTGAGAGG - Intergenic
1051683716 9:19634929-19634951 CTTCATCAGCAAAAATTGAGTGG - Intronic
1051712424 9:19945664-19945686 CTTCATCTGTAAATTAGGGGTGG - Intergenic
1052610347 9:30764801-30764823 CTTATTCTTCAAAATGTGGAGGG - Intergenic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1053418945 9:37964794-37964816 CTTCATCTGTACAGTGGGGGCGG - Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053639815 9:40061064-40061086 CTTCATTTGCAAAAGGTTGTTGG - Intergenic
1053766318 9:41404420-41404442 CTTCATTTGCAAAAGGTTGTTGG + Intergenic
1054320566 9:63657381-63657403 CTTCATTTGCAAAAGGTTGTTGG - Intergenic
1054544934 9:66315576-66315598 CTTCATTTGCAAAAGGTTGTTGG + Intergenic
1054760661 9:69001347-69001369 CCACATTTGAAAAATGTGGGGGG - Intronic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1056089220 9:83187947-83187969 CTTCATCTGCAAGACGGGGGTGG + Intergenic
1056789645 9:89617264-89617286 CTTCATCTGAAACATCTGGAAGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057911035 9:99020913-99020935 CTCCATCTGTAAAATGGAGGTGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058714110 9:107708036-107708058 CTTCATTTGCAAAAACTGGTAGG - Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1059732631 9:117072035-117072057 CTTAATCTGTAAAATGGGAGTGG - Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061537089 9:131256946-131256968 CTTCGTCTGTGAAATGGGGGTGG + Intergenic
1062363429 9:136198045-136198067 CCTTGTCTGCAAAATGTGGGTGG - Intronic
1062720122 9:138036763-138036785 CAACATTGGCAAAATGTGGGTGG - Intronic
1203748500 Un_GL000218v1:57899-57921 CTGCAGCTGCAAACTGTGCGTGG + Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1191240981 X:58189921-58189943 CTTTATCTTTAAAATGTGGGAGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1195195662 X:102495416-102495438 CTTTATCTACACAATGAGGGTGG + Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196885096 X:120236900-120236922 ATACATATGCAAAATGGGGGTGG + Intergenic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197806184 X:130400796-130400818 CTTCCTCTACAAAATGAGGGTGG + Intergenic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1197974020 X:132145947-132145969 CTTCGTCTCTAAAATGTGGAAGG - Intergenic
1198103068 X:133438590-133438612 CTTCATCTGTAAACTGAAGGTGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199114949 X:143980781-143980803 CTGCACGTGCAAAATGTGGCAGG + Intergenic
1199123156 X:144081978-144082000 CTTCATCTTGTAAATTTGGGTGG + Intergenic
1199406483 X:147467538-147467560 CTTCATCTGGAATATGTATGTGG + Intergenic
1199438541 X:147841991-147842013 CTTCATCTGGGGAATGGGGGAGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1201585634 Y:15557883-15557905 GTTCATCTGTCAAAGGTGGGAGG + Intergenic