ID: 924160517

View in Genome Browser
Species Human (GRCh38)
Location 1:241227106-241227128
Sequence ACTTATGTCAAGAGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924160512_924160517 -5 Left 924160512 1:241227088-241227110 CCAAGGACCTTAAAATTCACTTA 0: 1
1: 0
2: 1
3: 17
4: 220
Right 924160517 1:241227106-241227128 ACTTATGTCAAGAGGGGAAAAGG 0: 1
1: 0
2: 1
3: 12
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924160517 Original CRISPR ACTTATGTCAAGAGGGGAAA AGG Intronic
900931857 1:5742928-5742950 ACATCTCTCAAGAGGGGAGAGGG - Intergenic
904279786 1:29410847-29410869 ACTTATGACAAAAGGAGAAGGGG - Intergenic
904371515 1:30050430-30050452 ACTTATGACAAAAGGTGAAGAGG + Intergenic
904385989 1:30142525-30142547 AATCATGGCAAGAGGTGAAAGGG + Intergenic
904387808 1:30156615-30156637 ACTTATGTGAAGAAGGTCAATGG + Intergenic
905103510 1:35546301-35546323 ACTTAAGGCAAGTGAGGAAACGG + Intronic
905935493 1:41821014-41821036 TCTGAGGGCAAGAGGGGAAAGGG - Intronic
906328249 1:44862542-44862564 AGTTATTTCAAGGGAGGAAAGGG + Intronic
907378732 1:54067150-54067172 ACTGATGTCAAAAGGAGAAGTGG + Intronic
908773267 1:67615400-67615422 ACTAATGCCTGGAGGGGAAACGG + Intergenic
909364897 1:74808125-74808147 ACTCATGGCAGAAGGGGAAAGGG + Intergenic
909809916 1:79920046-79920068 CCTTATGTCAACAGAGGTAAAGG - Intergenic
912479554 1:109970781-109970803 ATTCATGGCAAGAGGGGAAGGGG - Intergenic
914781727 1:150791773-150791795 ACGTAAGTCTAGTGGGGAAATGG - Intergenic
915140952 1:153768292-153768314 ACTTCTACCAAGAGGAGAAAGGG - Intronic
915885610 1:159717972-159717994 ACTTATGTTTAAAAGGGAAAGGG + Intergenic
916289961 1:163154550-163154572 ACTTGTGAAAAGAAGGGAAAAGG + Intronic
917777521 1:178353198-178353220 ACTTATATTTAAAGGGGAAATGG - Intronic
918093747 1:181318031-181318053 AATTATTTTAAAAGGGGAAAGGG - Intergenic
918789499 1:188808248-188808270 AATTATGGCAAAAGGGGAAGGGG + Intergenic
920577913 1:207075766-207075788 ACTTGTCTAAAGTGGGGAAAGGG + Exonic
924160517 1:241227106-241227128 ACTTATGTCAAGAGGGGAAAAGG + Intronic
924526260 1:244853151-244853173 ACATATTTAATGAGGGGAAAAGG - Intronic
1063398682 10:5719210-5719232 ACTTATATCAAAATGGGATATGG - Intronic
1068151229 10:53135096-53135118 AGTTTTGAAAAGAGGGGAAAAGG - Intergenic
1068168358 10:53360122-53360144 ACTTATGGAAAGAGAGTAAAAGG - Intergenic
1068883234 10:62072331-62072353 ACTTATGTGAACAAGTGAAATGG + Intronic
1069606228 10:69740397-69740419 ACTTCTGTGAAGAGAGCAAAGGG + Intergenic
1070874743 10:79792619-79792641 ACTCATGGCAAAAGGGGAAGGGG - Intergenic
1071362661 10:84865934-84865956 ACTTAATTCAAGAAGGAAAATGG + Intergenic
1071641670 10:87314788-87314810 ACTCATGGCAAAAGGGGAAGAGG - Intergenic
1071791005 10:88953848-88953870 ACTCATGGCAAAAGGGGAAGAGG - Intronic
1072179302 10:92965135-92965157 AATTATTCCAAGAGGGGGAATGG + Intronic
1073313335 10:102560107-102560129 TCTTTTGTAAACAGGGGAAAGGG - Intronic
1073941307 10:108701743-108701765 ACTGATGTCCAGAGGTGCAAAGG - Intergenic
1077879564 11:6338105-6338127 ACCTATGTCTAGAAGAGAAATGG - Intergenic
1078641939 11:13104857-13104879 AATCATGCCAAGAGAGGAAATGG - Intergenic
1079498737 11:21076879-21076901 ACTCATGGCAGGAGGGGAAGGGG - Intronic
1080633441 11:34102691-34102713 ACTGGTGTGAAGAGAGGAAAAGG + Intergenic
1080652233 11:34232078-34232100 AATAATGTTAATAGGGGAAACGG + Intronic
1081449827 11:43160661-43160683 CCTTATGTCAACAGGGGGAGAGG + Intergenic
1083820710 11:65169949-65169971 GCATTTGTCAAGAGGGGAACAGG + Intergenic
1086328201 11:85726204-85726226 AGTTATGGCAAGAGAGGAAATGG - Intronic
1088564094 11:111149339-111149361 ACTTATGGCACAAGGAGAAATGG + Intergenic
1090506341 11:127319770-127319792 AATTATGGCAAAAGGGGAAGGGG + Intergenic
1093189826 12:16060978-16061000 ACTTATGTTAAGAGGATTAAAGG + Intergenic
1093262401 12:16955073-16955095 ACTAATTTAAAGAGGGCAAACGG + Intergenic
1097581066 12:61457278-61457300 GCTTATGTGAAAAAGGGAAAAGG + Intergenic
1098072279 12:66688829-66688851 AATAATGTCTAAAGGGGAAAAGG + Intronic
1099574833 12:84365104-84365126 AATTATGACAATAGGTGAAAGGG + Intergenic
1099831844 12:87853855-87853877 ACATATGTTAAGAGGAGAATTGG - Intergenic
1100475910 12:94935182-94935204 CTTTAGGCCAAGAGGGGAAAGGG - Intronic
1101584722 12:106075407-106075429 ACTATTGATAAGAGGGGAAATGG + Intronic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1104090518 12:125512976-125512998 AAGGATGTCAGGAGGGGAAACGG + Intronic
1104283134 12:127396626-127396648 AAGGATGTCAGGAGGGGAAACGG - Intergenic
1106262529 13:28079874-28079896 ACTCATGACAGAAGGGGAAAGGG + Intronic
1106544998 13:30722893-30722915 ACTTATGGCAAAAGGAGAAGGGG - Intronic
1107465843 13:40649454-40649476 GTTTATGGCAAGAAGGGAAAAGG - Intronic
1107630202 13:42334971-42334993 ACTTATGCCAGGTGGTGAAAGGG - Intergenic
1109652663 13:65350851-65350873 ACTTACGTGAGGAAGGGAAAAGG + Intergenic
1110355582 13:74562964-74562986 ACATATGAAAAGAGGGGACAGGG - Intergenic
1111020269 13:82439243-82439265 AATTGTGTCATGAGGGCAAATGG + Intergenic
1111131272 13:83979098-83979120 ACTTGTATCAAGATGGGAATGGG - Intergenic
1112943697 13:104897836-104897858 AATTATGGCAGAAGGGGAAACGG - Intergenic
1114690065 14:24573324-24573346 ACATATGGCAAAAGGGGCAAGGG - Intergenic
1118939036 14:70315688-70315710 ACTTTTGTGAACAGAGGAAAGGG + Intergenic
1119947470 14:78710141-78710163 AATTATGACAAGAAAGGAAAAGG + Intronic
1120002308 14:79316491-79316513 AATTGTGGAAAGAGGGGAAAGGG + Intronic
1124550942 15:30680797-30680819 AATTAAGTCAAGAGGGGGCAGGG - Intronic
1124696215 15:31866840-31866862 ACTGATTTCAAGGGGGCAAATGG - Intronic
1125347819 15:38736783-38736805 ATTCATGGCAGGAGGGGAAAAGG + Intergenic
1130682628 15:86010005-86010027 CCTTATTTCAAGGTGGGAAATGG + Intergenic
1132080300 15:98858514-98858536 ATTCATTTCAAGAGGGGAGAGGG - Intronic
1133877983 16:9752694-9752716 CCTTATGGCAAGAGGGAAAAGGG - Intergenic
1135052948 16:19207143-19207165 ACTTTTGTCAGAAGGGGAAAGGG - Intronic
1135518657 16:23156509-23156531 ACTTATGGCAGAAGGTGAAAGGG - Intergenic
1139032025 16:62895681-62895703 ACTCATGGCAGAAGGGGAAAGGG - Intergenic
1140144333 16:72291005-72291027 ACTTATGTCACACTGGGAAAAGG + Intergenic
1140151402 16:72370986-72371008 ACTTACCTCAAAAGGTGAAACGG - Intergenic
1140708547 16:77654522-77654544 ATTCATGTGAATAGGGGAAAAGG - Intergenic
1141502663 16:84454638-84454660 ACTGAGGTCAAGAGGGTCAAGGG + Intronic
1144027279 17:11288907-11288929 ACTTCTTTCTAGAGTGGAAATGG + Intronic
1145924668 17:28637315-28637337 AGTTAGGTTAAGATGGGAAAGGG - Intronic
1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG + Intronic
1147232369 17:39028834-39028856 ACTTATGTCAAGCCAGGAACAGG + Intergenic
1148019899 17:44546847-44546869 CATTATGGCAGGAGGGGAAATGG - Intergenic
1150921323 17:69486717-69486739 ATTTATGTCAAGTAGGGAATAGG + Intronic
1151654377 17:75488947-75488969 TCTTCTGTGAAGAGGGGAATGGG + Intronic
1151967470 17:77438958-77438980 TCATTTGTCAAAAGGGGAAATGG - Intronic
1152173305 17:78768829-78768851 ATTTTTGCCAAGAGGGGGAAGGG - Intronic
1154129074 18:11720733-11720755 ACTTTTGTCAAGTTGTGAAAAGG + Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1161026481 19:2039585-2039607 ACCTATGTACAGAGGGGAGATGG + Exonic
1162209456 19:9079869-9079891 ACTGAGGTCAGGTGGGGAAAGGG + Intergenic
1162986970 19:14277211-14277233 GCTTATGTCAGGGGGAGAAAGGG - Intergenic
1165931633 19:39362867-39362889 ACTGAGGTCAGGAGGGGCAATGG + Intronic
926284947 2:11481836-11481858 CCTGAGGTCAAGAGAGGAAAAGG - Intergenic
927211176 2:20640136-20640158 ACGGATGTAAAGAGGGGAGAAGG + Intronic
927410921 2:22825413-22825435 ACTCATGGCAGCAGGGGAAAGGG - Intergenic
927860994 2:26559778-26559800 CCTGAGGTCAGGAGGGGAAAAGG - Intergenic
927900955 2:26817925-26817947 AATGATGGCAAGAGGGGAAAGGG + Intergenic
928002001 2:27531540-27531562 ACTCATGGCAGAAGGGGAAAGGG - Intergenic
929344689 2:40866869-40866891 CGTTATGTCAAGATGAGAAATGG + Intergenic
929461681 2:42106554-42106576 ACCGATGTCAATAGGGGCAAAGG - Intergenic
930487744 2:52028449-52028471 ACTTATGGAGAGAGGGGAAGTGG - Intergenic
930774299 2:55157526-55157548 ACTCATGCCAAGAGGGGAGCAGG + Intergenic
932022774 2:68104614-68104636 ACTTATGGCAGAAGGTGAAAGGG + Intronic
935303775 2:101717562-101717584 ACTTCTGTCATTAGAGGAAACGG + Intronic
935417962 2:102838428-102838450 ACCGATGTGAAGAGGGGGAAGGG + Intronic
936292854 2:111239763-111239785 ACTTATGTCTATAGGGGAGAGGG - Intergenic
936734554 2:115425849-115425871 ACTCATGGCAGGAGGTGAAAGGG + Intronic
939118015 2:138083495-138083517 CCTTAGGTCAGGAGGGGAAGTGG - Intergenic
939689090 2:145235505-145235527 ACTCATGTCAGAAGGTGAAAAGG + Intergenic
940332823 2:152493698-152493720 ACTTATGGCAGAAGGGGAAGAGG - Intronic
942311477 2:174660967-174660989 ACTGAAGTCAAGAGGGGCGAGGG + Intronic
943270556 2:185797095-185797117 ACATATTTTGAGAGGGGAAATGG - Exonic
943580556 2:189678683-189678705 ACAAATGTAAAGTGGGGAAAGGG - Intronic
943665061 2:190600672-190600694 ACTCATGGCAAAAGGTGAAAAGG - Intergenic
943771421 2:191721794-191721816 AGTCATGGCAACAGGGGAAAGGG - Intergenic
944922508 2:204430164-204430186 ACTTATGTAAAGAAAGCAAAAGG - Intergenic
945053863 2:205850714-205850736 ACTCATGGCAAGATGGAAAAAGG - Intergenic
945186229 2:207142662-207142684 ACTTTTGCCAAGTGGAGAAAGGG + Intronic
947288804 2:228547910-228547932 ACTTATGTGGAGAGAAGAAAGGG + Intergenic
947358202 2:229318647-229318669 ATTTATGAAAAGGGGGGAAATGG - Intergenic
1169985021 20:11434545-11434567 CCTTAGGTCAAGAGGGAAATGGG - Intergenic
1170939883 20:20839998-20840020 ACTCATGTTAAAAGGTGAAAGGG - Intergenic
1171104409 20:22418850-22418872 AGGTATGAAAAGAGGGGAAAAGG + Intergenic
1172852529 20:37976982-37977004 AATTATATAAGGAGGGGAAACGG + Intergenic
1174348490 20:49949412-49949434 ACTCTTCTCAAAAGGGGAAATGG + Intronic
1174522682 20:51143905-51143927 ACTTATGTCACTAAGGTAAATGG + Intergenic
1174645741 20:52084162-52084184 ACTAATCTCTAGAGTGGAAAGGG - Intronic
1178791990 21:35709022-35709044 ACCCATGTCATCAGGGGAAATGG + Intronic
1179595517 21:42440468-42440490 ATATATGACAAGAGGGGAACAGG + Intronic
1180040459 21:45276652-45276674 AATCAAGTCAAGAGGGAAAAAGG + Intronic
1182774317 22:32819619-32819641 ATCTATGCCAAGAGGGGAACAGG - Intronic
1183018105 22:35006506-35006528 CCTTATGCCAAGAAGAGAAATGG + Intergenic
1183382273 22:37496142-37496164 ACTTAGGTCCAGAGGGGGCAGGG + Intronic
1185010499 22:48310190-48310212 GCTTTTGGAAAGAGGGGAAATGG - Intergenic
1185179242 22:49349798-49349820 GCTTATGTCCTGAGGGGCAATGG + Intergenic
949640075 3:6026455-6026477 AATTATCTCAATAGGAGAAAAGG - Intergenic
950120688 3:10480702-10480724 ACTGATGGCAGAAGGGGAAATGG - Intronic
950824164 3:15798675-15798697 ACCTATGTCAAAAGGGCACAGGG + Intronic
951653877 3:24982648-24982670 AATTATGGAAAGAGGAGAAAAGG - Intergenic
954504072 3:51051809-51051831 ACTCATGTCAGGAGGCAAAATGG + Intronic
955053186 3:55431975-55431997 ACTTATGTATCGAGGGGTAATGG - Intergenic
957362894 3:79182345-79182367 ACAAATGCTAAGAGGGGAAAAGG - Intronic
960548650 3:118948485-118948507 ACTCAAGTTAAGTGGGGAAAAGG + Intronic
961154668 3:124669118-124669140 ACTTTTTTCAAGTGAGGAAAAGG + Intronic
962005449 3:131344714-131344736 ACTTATGGCAGAAGGGGAAGTGG + Intronic
962894164 3:139698944-139698966 ACTCATGTCAGAAGGGGAAGGGG - Intergenic
963415509 3:144991081-144991103 ACTTATGTCAGTGGTGGAAATGG - Intergenic
964386743 3:156155699-156155721 AATGATGTCAAGAAGGTAAAGGG + Intronic
965332123 3:167388666-167388688 AGTTGTGTCCAGAGGGTAAAAGG + Intergenic
966811084 3:183845603-183845625 ATTTATGCAAAGATGGGAAAAGG + Intronic
967694812 3:192517514-192517536 TCTTATGACCAGAGAGGAAATGG + Intronic
968378993 4:72720-72742 ACTTATGTTCACAGGAGAAATGG - Intronic
970378439 4:15481592-15481614 ACTTATGTCAGAAGGGGAAGGGG - Intronic
971745696 4:30576946-30576968 ACTAATGTTAAGAAGGAAAAGGG + Intergenic
971949892 4:33331777-33331799 CTTTATTTCAAGAGGGAAAATGG + Intergenic
972930388 4:44064640-44064662 ACTCATGGCAAGAGGGGAAGTGG - Intergenic
973305278 4:48641164-48641186 ACTAATGTGAAGAGGAAAAAAGG + Intronic
975327449 4:73075968-73075990 AGTTATGTCCAAAGGGGAAGAGG + Exonic
976053434 4:81033789-81033811 ACATATGTCACAAGGTGAAAGGG - Intronic
976369154 4:84267112-84267134 ACTAAAGTCAAGAGAGGAACAGG + Intergenic
977700253 4:100013986-100014008 ACATATGTCAAGAGAAGAGAGGG + Intergenic
977860475 4:101953045-101953067 ACCTATGTGAACAGGTGAAATGG + Intronic
979519573 4:121650864-121650886 ACTTATGTCAGGAAGACAAAAGG - Intergenic
980774959 4:137425741-137425763 TCTTCTGTGGAGAGGGGAAAGGG + Intergenic
983573707 4:169237501-169237523 GCTGATTTCAAGAGGGGAAATGG + Intronic
983891992 4:173039039-173039061 AATTGTGTTAAGTGGGGAAAAGG - Intronic
984448847 4:179873112-179873134 ACCTAGGTCAAAAAGGGAAATGG + Intergenic
985194644 4:187415771-187415793 GCTCATCTCAAAAGGGGAAAAGG + Intergenic
986604195 5:9505251-9505273 ACTTATTTCTAGAAGGCAAAAGG + Intronic
989746757 5:44838968-44838990 ACTTATATCTAGAAGGGAAGTGG + Intergenic
990353485 5:54941628-54941650 AATTTTTTAAAGAGGGGAAAAGG + Intergenic
991312512 5:65259631-65259653 AATAATGTGAAGAGAGGAAATGG + Intronic
991444253 5:66682683-66682705 ACTTATCTGAAGAGGTGAAGGGG + Intronic
992475151 5:77094742-77094764 ACTTATGATAAAAGGGGAAGGGG + Intergenic
992848859 5:80783764-80783786 ACTCATGTCCAGAGAGGCAAGGG + Intronic
992968478 5:82029413-82029435 ATGTATGTCATGATGGGAAAAGG + Intronic
993302229 5:86225417-86225439 ACTTATTTCAGGAGGGGGCATGG - Intergenic
995787834 5:115849543-115849565 AATTATGTCAAGAAGGGGCATGG - Intronic
996192946 5:120567736-120567758 ACTTATGGCAGAAGGGCAAAGGG - Intronic
996328183 5:122299805-122299827 TCTTATTTAAAAAGGGGAAATGG + Intergenic
997983139 5:138482771-138482793 AATTCTGTCAAGAGGAGAGATGG + Intergenic
1000358506 5:160424503-160424525 TCTTAGGTCAGGAGGGGAATAGG + Intronic
1000781519 5:165488318-165488340 ACTTATTGCAGGAGGGGAGAGGG - Intergenic
1000900614 5:166907568-166907590 TCTTATGTCAGGAAGGGAGAGGG + Intergenic
1001701137 5:173707248-173707270 CCATCTCTCAAGAGGGGAAAAGG - Intergenic
1002032502 5:176440894-176440916 ACTTATGACAAAAGGTGAAGGGG + Intergenic
1005060750 6:21774801-21774823 GCTTATGTCCAGAGGGGGAAAGG + Intergenic
1005498904 6:26412968-26412990 TCTTGTGTCCAGAGGGGAAGAGG - Intronic
1007273353 6:40655523-40655545 ACCTGTGTCCAGAGGGAAAAGGG + Intergenic
1007435576 6:41808182-41808204 ACTTAGGACAAGAGGTGAAGTGG + Intronic
1010419571 6:75656715-75656737 ACCAATGTCATGAGGAGAAATGG - Intronic
1013017951 6:106178271-106178293 AATAATGTCAAGAGTGGAAAGGG - Intergenic
1015373738 6:132486620-132486642 ATTTATGTCATGAGATGAAATGG + Intronic
1015910609 6:138164910-138164932 ACTTAGGTCATCATGGGAAAGGG + Intronic
1016117134 6:140301321-140301343 ACTTAAGTCATGATGGGAAGTGG + Intergenic
1018058139 6:160069991-160070013 ACTTATGTCCAGATGGGATTCGG + Exonic
1020502097 7:8936257-8936279 AATTTGGTCAGGAGGGGAAAAGG + Intergenic
1024396168 7:48869890-48869912 ACTAATGTCCAGAAGTGAAAAGG + Intergenic
1024740826 7:52352564-52352586 ACTTATTTGAAGATGGAAAAAGG + Intergenic
1027606091 7:80300697-80300719 ACTTATGTCAAGAAAGAGAAAGG + Intergenic
1028965067 7:96793077-96793099 ACTTCTGGCAAGAGAGGGAATGG + Intergenic
1029676359 7:102071816-102071838 ACTGAAGTCCAGAGAGGAAAAGG - Intronic
1030016444 7:105227334-105227356 ACTTAGGGGAAGAGTGGAAAGGG - Intronic
1032889362 7:136178064-136178086 AATTACGTCCAGAAGGGAAAAGG - Intergenic
1033271457 7:139936505-139936527 ATTTATGGCAAGTGGGGATATGG - Intronic
1035549542 8:509837-509859 ACTTATGTTAAAAGGGAAACAGG - Intronic
1035781365 8:2230540-2230562 GCTGATGTCAAGAAGGGAAGCGG - Intergenic
1035786947 8:2269172-2269194 AGTTTTGCCAAGAGGAGAAAGGG - Intergenic
1035805860 8:2452544-2452566 AGTTTTGCCAAGAGGAGAAAGGG + Intergenic
1042958170 8:74274089-74274111 GATTATGTCAAAAAGGGAAAAGG - Intronic
1043035710 8:75196157-75196179 ATTAATGACAATAGGGGAAATGG + Intergenic
1043765839 8:84131198-84131220 GCTTCTCTGAAGAGGGGAAATGG - Intergenic
1044636690 8:94332288-94332310 ACTTATGGCAGAAGGTGAAAGGG + Intergenic
1045340147 8:101246476-101246498 ACTCATGTCAAAAGGCAAAAGGG + Intergenic
1045367366 8:101489027-101489049 ACTTATGAAAGGAGAGGAAAAGG + Intergenic
1045687596 8:104727884-104727906 ACTGAAGTCCAGAGAGGAAATGG - Intronic
1046175959 8:110575323-110575345 ACTTATGGCAAAAGGGGAAGGGG + Intergenic
1046549876 8:115702444-115702466 AATATTTTCAAGAGGGGAAAGGG - Intronic
1048247075 8:132817378-132817400 ACTTAAGTCAAGAGGGAGACAGG - Exonic
1050063914 9:1738703-1738725 AATTTTATCAAGAGGGGATAGGG - Intergenic
1050706641 9:8407054-8407076 ACATGTGGCAAGAGTGGAAATGG - Intronic
1051762153 9:20479408-20479430 TCTTATAGCAAGAGGGAAAATGG + Intronic
1053391383 9:37738990-37739012 CCATATTGCAAGAGGGGAAAAGG + Intronic
1054701754 9:68419807-68419829 AATTCTGTCAAGAGGGGAAAAGG - Intronic
1055673969 9:78636187-78636209 ACTTCTACCAAGAGGGGAATGGG + Intergenic
1056031628 9:82559723-82559745 CCTTATTTCAGAAGGGGAAAAGG + Intergenic
1185812164 X:3120707-3120729 ACATTTGTCAAGAAGGAAAAAGG + Intergenic
1187625467 X:21107768-21107790 AGTAATCACAAGAGGGGAAAAGG + Intergenic
1187948868 X:24452652-24452674 ACTTATGTCAGAGGGGGAAGGGG + Intergenic
1188279189 X:28242319-28242341 ACACATGTCAATGGGGGAAACGG - Intergenic
1188954043 X:36413512-36413534 AATTATGTCAGAAGGGGAAAGGG + Intergenic
1190712222 X:53079200-53079222 ACTTCTATAAAGAAGGGAAAGGG - Exonic
1191746544 X:64495445-64495467 ACATATGTCAAGAGGTGAGGGGG - Intergenic
1191810684 X:65184264-65184286 TATTCTGTCAAAAGGGGAAAGGG - Intergenic
1192297481 X:69866357-69866379 TCTTAAGTCAACAGGGTAAAAGG - Intronic
1192706338 X:73531092-73531114 AATTATGTCAAGATAGGTAATGG - Intergenic
1193165159 X:78271892-78271914 ACTTATCTGAAGAAGAGAAAAGG - Exonic
1193455029 X:81721098-81721120 ATTTATATCAAGAAGGCAAAAGG + Intergenic
1193919816 X:87411049-87411071 AATCATGGCAAAAGGGGAAAGGG + Intergenic
1193962003 X:87938013-87938035 TCTTATGTTTTGAGGGGAAAAGG - Intergenic
1194153241 X:90352731-90352753 AGTTATGAAAAGAGGGGAAGGGG + Intergenic
1194397721 X:93405891-93405913 AATTATATCAAGATGGGAGAAGG + Intergenic
1196520886 X:116669288-116669310 ACCTGTGTCAATAGGGGCAATGG - Intergenic
1196624026 X:117857242-117857264 ACTGAAGTCAGGAAGGGAAAGGG + Intergenic
1200499584 Y:3929521-3929543 AGTTATGAAAAGAGGGGAAGGGG + Intergenic