ID: 924161572

View in Genome Browser
Species Human (GRCh38)
Location 1:241238375-241238397
Sequence CTCGGTTAGCAGGACTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 6, 3: 29, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924161572_924161575 -8 Left 924161572 1:241238375-241238397 CCATCTGAGTCCTGCTAACCGAG 0: 1
1: 0
2: 6
3: 29
4: 89
Right 924161575 1:241238390-241238412 TAACCGAGGACCAACTATTTAGG 0: 1
1: 0
2: 0
3: 0
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924161572 Original CRISPR CTCGGTTAGCAGGACTCAGA TGG (reversed) Intronic
900725437 1:4213527-4213549 CTGGGCTAGCGGGGCTCAGAAGG + Intergenic
904632021 1:31849424-31849446 CTCAGGTTGCAAGACTCAGAAGG - Intergenic
906067897 1:42995315-42995337 CTAAGTCAGCAGGTCTCAGATGG + Intergenic
906535923 1:46550955-46550977 CTGGGTCAGCAGGAATCAGCTGG - Intronic
913046070 1:115074402-115074424 CTCAGTGAGGAGGAGTCAGAGGG + Intronic
913972512 1:143425055-143425077 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
914066896 1:144250668-144250690 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
914112257 1:144715686-144715708 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
919006567 1:191907031-191907053 CTATGTTAGCAGGAGTCACATGG - Intergenic
922218605 1:223540716-223540738 CTTTGTCAGCAGGACTCAGCAGG - Intronic
924161572 1:241238375-241238397 CTCGGTTAGCAGGACTCAGATGG - Intronic
924812658 1:247416749-247416771 CTGGGTTTGCAGGGCTCAGGAGG + Intronic
1063498092 10:6528418-6528440 CTCGGTTGGCAGGGGTGAGAGGG + Intronic
1063515902 10:6694939-6694961 CTGTGGTAGCATGACTCAGAGGG - Intergenic
1066747440 10:38615524-38615546 CTCAGTGGGCAGGATTCAGAGGG + Intergenic
1075011650 10:118875469-118875491 CTCTGTTACCAGGTCTAAGAGGG + Intergenic
1078186267 11:9054325-9054347 CTCCATTAGCAACACTCAGAAGG + Intronic
1079029710 11:16977408-16977430 CACAGTTAGCAGGACTGACATGG - Intronic
1079893279 11:26085457-26085479 CTTGTTGAGCAGGAGTCAGATGG + Intergenic
1081892786 11:46558050-46558072 CTAGGTTAGAAGGTCTAAGAAGG - Intronic
1096372718 12:51082860-51082882 GAAGGTTAGCAGGAATCAGAGGG - Intronic
1102943278 12:116962535-116962557 CATGGTTAGCAGGAAGCAGAAGG + Intronic
1105074596 12:133264602-133264624 CTCGGTGCGCAGGATTCAGAGGG - Intergenic
1111241748 13:85483143-85483165 CAGGCTTAGGAGGACTCAGATGG - Intergenic
1114031193 14:18582730-18582752 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1122839285 14:104447255-104447277 CTCTGGGAGCAGGACTTAGAAGG + Intergenic
1202899874 14_GL000194v1_random:28821-28843 CTCGGTGGGTAGGATTCAGAGGG - Intergenic
1131729677 15:95266819-95266841 CTCTGTTAGCAGGTCTCATCTGG + Intergenic
1132453566 16:10177-10199 CTCGGTGCCCAGGATTCAGAGGG + Intergenic
1136735363 16:32462069-32462091 CTCGGTGGGCAGGATTCAGAAGG - Intergenic
1139656624 16:68391242-68391264 CTCTGTTAGTTGGACTCAGAAGG + Intronic
1141478851 16:84292840-84292862 CTGGGTTTACAGGACTCTGATGG + Intergenic
1203017719 16_KI270728v1_random:367522-367544 CTCGGTGGGCAGGATTCAGAAGG + Intergenic
1203036054 16_KI270728v1_random:640680-640702 CTCGGTGGGCAGGATTCAGAAGG + Intergenic
1148578530 17:48727849-48727871 CTTGGTTATTAGGACTCTGAAGG - Intronic
1151230828 17:72683956-72683978 CTCCACTAGCAGGAGTCAGATGG - Intronic
1154486905 18:14879255-14879277 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
1157200274 18:45653720-45653742 CCCAGTCAGCAGGAATCAGAAGG + Intronic
1160131685 18:76231041-76231063 CTAGGACAGCAGGACTCTGAGGG - Intergenic
1160653344 19:246125-246147 CTCGGTGCGCAGGATTCAGAGGG + Intergenic
1202647612 1_KI270706v1_random:156853-156875 CTCCGTTGGCAGGATTCAGAGGG + Intergenic
925566222 2:5257337-5257359 CACGGTCAGCAAGACTAAGATGG + Intergenic
934177210 2:89586022-89586044 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
934287511 2:91660335-91660357 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
934310404 2:91857654-91857676 TTCGGTGGGCAGGATTCAGAGGG + Intergenic
938496999 2:131802986-131803008 TTCGGTGGGCAGGATTCAGAGGG - Intergenic
938547912 2:132352315-132352337 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
940856980 2:158736855-158736877 CTCATTTTGCAGGTCTCAGATGG + Intergenic
946137167 2:217656902-217656924 CTCTGATAGGAGGACTCCGAAGG - Intronic
948261320 2:236606389-236606411 CTGGGCTAGCAGGACAGAGAGGG - Intergenic
948972791 2:241442123-241442145 CTCAGTGAGCTGGTCTCAGAAGG - Intronic
1169560998 20:6800582-6800604 GCTGGTTAGCAGGACTCGGATGG - Intergenic
1171876780 20:30585088-30585110 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1173891923 20:46519415-46519437 CTGGGCTGGCAGGACTCACAAGG - Intergenic
1176604247 21:8815907-8815929 CTCGGTTGGCAGGATTCAGAGGG - Intergenic
1176619248 21:9043595-9043617 CTCGGTGGGTAGGATTCAGAGGG - Intergenic
1176706299 21:10121807-10121829 CTCGGTGGGTAGGATTCAGAGGG - Intergenic
1176794381 21:13360079-13360101 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1180346538 22:11707514-11707536 CTCGGTTGGCAGGATTCAGAGGG - Intergenic
1180354302 22:11825638-11825660 CTCGGTGGTCAGGATTCAGAGGG - Intergenic
1180383952 22:12166717-12166739 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1180455305 22:15509788-15509810 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1180537152 22:16403593-16403615 CTCAGTGGGCAGGATTCAGAGGG + Intergenic
953924632 3:46976363-46976385 CCCGGGAAGCAGGAGTCAGATGG + Intronic
954438312 3:50507804-50507826 CTGGGTAAACAGGGCTCAGAAGG - Intergenic
960195525 3:114762679-114762701 CTAGGTTAGTATGGCTCAGACGG - Intronic
962025843 3:131546750-131546772 CTGGGGTACCAGGACTCACATGG - Intronic
973373870 4:49275042-49275064 CTCGGTTGGCAGGATTCAGAGGG + Intergenic
973383542 4:49335197-49335219 CTCGGTTGGCAGGATTCAGAGGG - Intergenic
973387147 4:49520211-49520233 CTCGGTTGGCAGGATTCAGAGGG - Intergenic
974596711 4:64022933-64022955 CAGGGTTAGCAGGACACAGTTGG - Intergenic
991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG + Intergenic
992158618 5:73979449-73979471 CTCGTTTTGCAGGAGTCAGAAGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996463919 5:123778433-123778455 CTCTGTCAGAAGGATTCAGAAGG - Intergenic
998415733 5:141945028-141945050 CTTGGGTAGCAGGAGTCAGGGGG - Exonic
999957024 5:156713485-156713507 CTCAGGTAGCAGCTCTCAGAAGG + Intronic
1002299476 5:178249150-178249172 CTGGGCCAGCAGGACTCAAAGGG - Exonic
1006266672 6:32931488-32931510 AGGGGTTATCAGGACTCAGAAGG - Intergenic
1006639422 6:35481786-35481808 CTCCGTTACCAGGACTCACTTGG + Intronic
1008394084 6:50986582-50986604 TTCTGTTAGCAGGATTCAGGAGG + Intergenic
1008885700 6:56430121-56430143 CTCGGTGACCACGACTCAAAGGG + Intergenic
1008977844 6:57448762-57448784 CTCGGTCAGCATGACTTATAGGG + Intronic
1009858820 6:69298260-69298282 ATCAGTTAGCAAGACACAGATGG - Intronic
1015865735 6:137724699-137724721 TTCAGTTAGCAGGGCTCAGCTGG + Intergenic
1024039622 7:45542194-45542216 CTGGGATGGCTGGACTCAGATGG - Intergenic
1024404765 7:48965745-48965767 CTTGGTTATCAGGAGTAAGATGG - Intergenic
1027663482 7:81016034-81016056 GTTGGTTAGCATGACTAAGATGG + Intergenic
1035496876 7:159335598-159335620 CTCGGTGCACAGGATTCAGACGG - Intergenic
1035512868 8:205859-205881 CTCGGTGCGCAGGATTCAGAGGG + Intergenic
1037871626 8:22502843-22502865 TTGGGTTAGGAGGACTTAGAGGG + Intronic
1042740823 8:72043909-72043931 CTGGGTTAGTAGGTCTAAGATGG + Intronic
1042756457 8:72218855-72218877 CTGGGTTAGTAGGTCTAAGATGG + Intergenic
1044498860 8:92927728-92927750 CTCAGTTAGAAAGACTGAGAAGG + Intronic
1044949139 8:97418471-97418493 CTCAGTTGGCTGGACTCAGTTGG + Intergenic
1045013039 8:97975187-97975209 CTGGGTTATCAGGATTCATATGG + Intronic
1048406887 8:134132347-134132369 CTCTGTCAGCTGCACTCAGATGG + Intergenic
1049882972 9:10594-10616 CTCGGTGCGCAGCATTCAGAGGG + Intergenic
1052337002 9:27330393-27330415 CTGGGCTAGCAGCACTCAGAAGG + Exonic
1053077014 9:35141758-35141780 CTCTGTTAGCATGACTGTGAGGG + Intergenic
1053475062 9:38376686-38376708 CTGGGCCAGCAGTACTCAGAGGG - Intergenic
1053643583 9:40108924-40108946 CTCGGTGGGTAGGATTCAGAGGG - Intergenic
1053752987 9:41274464-41274486 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
1053762570 9:41356566-41356588 CTCGGTGGGTAGGATTCAGAGGG + Intergenic
1053884820 9:42636219-42636241 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1053887843 9:42658019-42658041 GTCGGTGGGCAGGATTCAGAGGG - Intergenic
1054223841 9:62443670-62443692 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1054226863 9:62465469-62465491 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
1054258517 9:62838839-62838861 CTCGGTGGGCAGGATTCAGAGGG - Intergenic
1054324441 9:63706152-63706174 CTCGGTGGGTAGGATTCAGAGGG - Intergenic
1054333258 9:63781228-63781250 CTCGGTGGGCAGGATTCAGAGGG + Intergenic
1054541168 9:66267680-66267702 CTCGGTGGGTAGGATTCAGAGGG + Intergenic
1055521174 9:77082389-77082411 CTCAGGTAGCAGCTCTCAGAAGG - Intergenic
1056425512 9:86471754-86471776 CTCTGTCTGCAGGATTCAGATGG + Intergenic
1057217974 9:93239973-93239995 GATGGTAAGCAGGACTCAGATGG + Exonic
1058904958 9:109475173-109475195 CTTGGTGAGAAGGCCTCAGAGGG + Intronic
1202791335 9_KI270719v1_random:91896-91918 CTCGGTGGGTAGGATTCAGAGGG - Intergenic
1202800262 9_KI270719v1_random:169535-169557 CTCGGTGGGTAGGATTCAGAGGG + Intergenic
1203697572 Un_GL000214v1:113015-113037 CTCGGTGGGTAGGATTCAGAGGG + Intergenic
1203551645 Un_KI270743v1:168004-168026 CTCGGTTGGCAGGATTCAGAGGG - Intergenic
1186767975 X:12791123-12791145 CGCGGTTAGCTGGGCACAGAGGG - Intergenic
1187581551 X:20612678-20612700 CTCAGCTGGGAGGACTCAGATGG + Intergenic
1199758689 X:150888851-150888873 CTCAGCTAGGAGGACTCAAATGG - Intronic
1200402861 X:156029743-156029765 CTCGGTGCGCAGCATTCAGAGGG - Intergenic
1201152913 Y:11103581-11103603 CTCGGTGGGCAGGATTCAGAGGG - Intergenic