ID: 924164159

View in Genome Browser
Species Human (GRCh38)
Location 1:241264880-241264902
Sequence CTTGACATCTTGGAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924164154_924164159 22 Left 924164154 1:241264835-241264857 CCTGTGGTATGAAGGCCTAAAAT 0: 1
1: 0
2: 0
3: 10
4: 92
Right 924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG No data
924164156_924164159 -5 Left 924164156 1:241264862-241264884 CCTCAATATGATATGTGCCTTGA 0: 1
1: 0
2: 1
3: 13
4: 218
Right 924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG No data
924164155_924164159 7 Left 924164155 1:241264850-241264872 CCTAAAATGAAGCCTCAATATGA 0: 1
1: 0
2: 3
3: 25
4: 249
Right 924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924164159 Original CRISPR CTTGACATCTTGGAAAAAAC AGG Intronic
No off target data available for this crispr