ID: 924164582

View in Genome Browser
Species Human (GRCh38)
Location 1:241268445-241268467
Sequence ATGAAAAATGTCTCTAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 356}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924164580_924164582 -10 Left 924164580 1:241268432-241268454 CCAAGTTGTGCCAATGAAAAATG 0: 1
1: 6
2: 84
3: 353
4: 1016
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164573_924164582 14 Left 924164573 1:241268408-241268430 CCCACTACACGCCAGGAGCACCC 0: 1
1: 0
2: 49
3: 285
4: 802
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164575_924164582 3 Left 924164575 1:241268419-241268441 CCAGGAGCACCCCCCAAGTTGTG 0: 1
1: 2
2: 12
3: 46
4: 170
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164576_924164582 -6 Left 924164576 1:241268428-241268450 CCCCCCAAGTTGTGCCAATGAAA 0: 1
1: 1
2: 7
3: 52
4: 249
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164572_924164582 20 Left 924164572 1:241268402-241268424 CCTCTACCCACTACACGCCAGGA 0: 1
1: 1
2: 54
3: 412
4: 1067
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164579_924164582 -9 Left 924164579 1:241268431-241268453 CCCAAGTTGTGCCAATGAAAAAT 0: 1
1: 2
2: 46
3: 164
4: 746
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164574_924164582 13 Left 924164574 1:241268409-241268431 CCACTACACGCCAGGAGCACCCC 0: 1
1: 0
2: 40
3: 180
4: 670
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164577_924164582 -7 Left 924164577 1:241268429-241268451 CCCCCAAGTTGTGCCAATGAAAA 0: 1
1: 3
2: 15
3: 90
4: 448
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356
924164578_924164582 -8 Left 924164578 1:241268430-241268452 CCCCAAGTTGTGCCAATGAAAAA 0: 1
1: 2
2: 38
3: 130
4: 593
Right 924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG 0: 1
1: 0
2: 5
3: 50
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924164582 Original CRISPR ATGAAAAATGTCTCTAGATA TGG Intronic
900187407 1:1338854-1338876 ATGAAAAGTGTCTGTAGAAGTGG - Intronic
901842106 1:11960351-11960373 ATCAACAATGTCTCTGGATGTGG + Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
903807376 1:26015187-26015209 ATGAAAAAAGTTTGTACATAGGG + Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
905197946 1:36295726-36295748 CTGACAAATTTCTCTAGAAAGGG - Intronic
905217152 1:36416870-36416892 ATGTAAAATGTCTCCAGCCAGGG - Intronic
905497926 1:38409541-38409563 ATAAAATATGTCTCAATATATGG + Intergenic
905635286 1:39546982-39547004 ATGAAAAATGTAGCTGGTTATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906286884 1:44593379-44593401 ATGAAAAATTTCTTTAGATAGGG - Intronic
906970022 1:50503007-50503029 ATTAAAAATGTTTTTAGAGATGG + Intronic
907627244 1:56042332-56042354 ATCAAAAATGTACCTACATATGG + Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
909291386 1:73887980-73888002 ATGAAAAATATTAATAGATATGG - Intergenic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
911866133 1:103024766-103024788 ATGTAAAATGTCTCTCAATTAGG - Intronic
912540322 1:110409967-110409989 ATGAATAATTTCTCTAGAGCAGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912919514 1:113852635-113852657 TTGAATCATGTCTCTAGAGATGG - Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916841709 1:168608124-168608146 ATGAAAAATGACTCCATATCCGG - Intergenic
917433138 1:174992086-174992108 TTGAACAAGGTCTTTAGATAAGG - Intronic
918128990 1:181608490-181608512 ATGAAAAGTGTCTGGAGAAATGG + Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918970370 1:191407470-191407492 TTGAAAAATGTATATACATATGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921646170 1:217620825-217620847 AGGAAAACTGGCTCTAGAAAAGG - Intronic
921827277 1:219687298-219687320 CTGGAAAATGTCTTTAGAAAAGG + Intronic
922489977 1:226008231-226008253 AAGAAAAAGTTCTCTAGAAAGGG + Intergenic
923385814 1:233464344-233464366 ATGAGAAACGTCTGGAGATAGGG - Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
924845068 1:247759107-247759129 ATGAAAAATGTTGATAGGTATGG - Intergenic
1062985191 10:1761856-1761878 ATGAACAAAGGCTTTAGATAAGG - Intergenic
1063027139 10:2191520-2191542 ATGAAAAATATATATATATAAGG - Intergenic
1063754533 10:8992163-8992185 ATGAACAAAGTCTTTATATAAGG - Intergenic
1063987503 10:11521017-11521039 ATGAACAATGTATCCAGTTAAGG - Intronic
1064698453 10:17991785-17991807 CTGATAAATGTCTACAGATATGG + Intronic
1064780044 10:18826105-18826127 ATTAAAAATGTCAGTATATAAGG + Intergenic
1064809220 10:19176318-19176340 ATGAAAAATGTCTTTAATAAAGG - Intronic
1065330193 10:24587955-24587977 AAGAAAAATGCATCTAGAGAAGG + Intronic
1065370792 10:24983182-24983204 ATGAAAAATGTATCTTTATCAGG + Exonic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065570673 10:27068479-27068501 ATGTAAAAGGTTTCTAGACAGGG + Intronic
1067958257 10:50817710-50817732 ATGCAAAACATCTCTTGATATGG - Intronic
1068138607 10:52976173-52976195 ATGAAAAATGTCTGGATATATGG + Intergenic
1069270728 10:66524122-66524144 ATGAAAAATGTTTCCTGAGACGG - Intronic
1069681182 10:70286588-70286610 AAGAAAAATGTCTGTAGAAGAGG - Intergenic
1070481679 10:76889115-76889137 ATGTAAAATATCTCTATATTAGG + Intronic
1072817957 10:98528106-98528128 TTGAAGAATGTCTCTAAATTTGG + Intronic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1077945911 11:6898324-6898346 ATAAAATATGTCACTGGATATGG + Intergenic
1078872711 11:15363890-15363912 ATAAAAAATGTCTATGGACATGG - Intergenic
1080014277 11:27488392-27488414 ATGAAAAATTTATGTAGAAATGG + Intergenic
1080942614 11:36936830-36936852 ATGTATACTGTCTCTAGTTAGGG - Intergenic
1080961800 11:37168993-37169015 ATGAAAAGCTTCTCTTGATATGG + Intergenic
1081373359 11:42330947-42330969 ATAAAAAATGTCTTTAAATATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1084198819 11:67541828-67541850 ATAAAAAATGTTTTTAGAGATGG - Intergenic
1085038303 11:73312590-73312612 ATGAAAAAAGCTTCTAGATGGGG + Intronic
1086312899 11:85555684-85555706 ATGAAAAGTCTCTCTGGGTATGG - Intronic
1086941902 11:92807030-92807052 ATGAAAAATCTGTCTGGACATGG + Intronic
1087202209 11:95357191-95357213 ATGAGAAATGTCACAAGAAAAGG + Intergenic
1089020436 11:115208707-115208729 ATGAAGGATTTCCCTAGATAAGG - Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090486014 11:127112706-127112728 ATAAGAAATGTGTCTAAATATGG + Intergenic
1091123500 11:133076430-133076452 AAGAAAAATGTCCCTGCATATGG + Intronic
1091236615 11:134026406-134026428 AAGCAAAATGTCTCTAATTAAGG + Intergenic
1092321602 12:7482372-7482394 ATGAAAAAAATCTGTAGAAATGG + Intronic
1094270038 12:28603322-28603344 AAGGAAAATGTCTTTATATATGG - Intergenic
1095107517 12:38253198-38253220 ATGAAAAAAATGGCTAGATATGG - Intergenic
1096091405 12:48904249-48904271 AAGAAAAATGTCCCTAGAAAGGG - Exonic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1096756349 12:53802983-53803005 ATGAAGAATGGGTCTAGATGGGG + Intergenic
1097384153 12:58929724-58929746 ATGACAAATGTCTCAAGGTGAGG + Intergenic
1097610988 12:61820028-61820050 TTAAAAAATGTTTCTGGATAAGG - Intronic
1097997857 12:65909522-65909544 ATGAAAAATATCTAAAGCTAAGG + Intronic
1098099620 12:67000875-67000897 ATGAAAACTGTTTCAGGATAAGG + Intergenic
1098407504 12:70141651-70141673 AGGATAAATGTATCTGGATATGG + Intergenic
1098423599 12:70332817-70332839 ATTAAAAATGTTACTTGATAAGG - Exonic
1098626018 12:72669830-72669852 ATGAAAAATATCTTTATATGTGG - Exonic
1099905781 12:88768181-88768203 ATGAAATATATCTCAAGAGAAGG - Intergenic
1100088606 12:90941336-90941358 TTCAAAAATCTCTCTGGATATGG - Intronic
1100095814 12:91034876-91034898 ATTAAAAATGTTGCTATATATGG + Intergenic
1102904567 12:116664539-116664561 ATGAAGTAAGTCTCTAAATATGG + Intergenic
1103578975 12:121900093-121900115 ATGATAAATGTCCCAAGAGAGGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108139384 13:47402865-47402887 GAGAAAAATGTATCTAGATAGGG - Intergenic
1108280494 13:48856480-48856502 ATGAACAATGTCTCTGCATCAGG - Intergenic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108918698 13:55649783-55649805 ATGAAAAATGTCTCTAATCCAGG + Intergenic
1110215700 13:73022293-73022315 ATTAAAAATGCCTCAAAATAAGG - Intergenic
1110394664 13:75015453-75015475 TAGAAAAATATCTCCAGATAAGG + Intergenic
1111755230 13:92385084-92385106 ATGAAAACTCTCCCCAGATATGG + Intronic
1112214468 13:97416156-97416178 ATTTAAAATGTCTCTAGTTAAGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1114737664 14:25059301-25059323 ATTAAAAATTTCTCTAGGTCAGG + Intergenic
1115159083 14:30372877-30372899 ATGAAAATTGTCTTTGGATTAGG - Intergenic
1115575335 14:34705457-34705479 ATGAAAAATGTCTAGATAAAGGG + Intergenic
1115647077 14:35376086-35376108 TTGAAAAGTGTCTCTCCATAAGG - Intergenic
1116892470 14:50282133-50282155 ATTAAAAATGTCTCTAGGCTAGG - Intronic
1117263027 14:54056360-54056382 ATCATAAATGTCAATAGATAAGG - Intergenic
1117439234 14:55744748-55744770 ATAAAAAATGCATCAAGATAGGG - Intergenic
1117968424 14:61229218-61229240 ATGAAAAACTTCTCTAAAGAAGG - Intronic
1119204596 14:72784600-72784622 ATGATAAATGACTCTTGATGAGG - Intronic
1122303033 14:100742532-100742554 ATGAAAAATGTCTCCAAGGATGG - Intergenic
1123501386 15:20885389-20885411 ATGAAATATGTCTTTTGATTGGG + Intergenic
1123558638 15:21459094-21459116 ATGAAATATGTCTTTTGATTGGG + Intergenic
1123594868 15:21896369-21896391 ATGAAATATGTCTTTTGATTGGG + Intergenic
1123960354 15:25392374-25392396 AATACAAATGTCTCTAGATTTGG - Intronic
1125353693 15:38793954-38793976 ATGAATAATGTTTCTAGTAAAGG - Intergenic
1126817973 15:52472377-52472399 ATGAAAAAAATGTCTGGATAGGG - Intronic
1127414687 15:58746602-58746624 AAGAAAAATGTCTTAAGACAAGG + Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131143551 15:89997681-89997703 CCGAAATATGTCTCTAGATAGGG + Intergenic
1131530206 15:93184362-93184384 AAAAAAAAAGTCTCTAAATATGG + Intergenic
1132228116 15:100159712-100159734 ATTAACAATGTCTCTTCATAAGG + Intronic
1202966987 15_KI270727v1_random:186247-186269 ATGAAATATGTCTTTTGATTGGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133583532 16:7169488-7169510 CTGAGAAATGTCTATAGACATGG + Intronic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133742179 16:8660014-8660036 ATGAAAAATGTGGCCAGATGTGG - Intergenic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134004283 16:10807512-10807534 ATGAAAAATGTCTCCTGATGTGG - Intronic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134530475 16:14978987-14979009 ATAAGAAATGTCTCAAGATGGGG + Intronic
1134621477 16:15692709-15692731 ATGCAAAATGGCTCTAGACTGGG - Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135419928 16:22298763-22298785 ATGATAAATCTCTATTGATAGGG + Intronic
1135458420 16:22619229-22619251 TTGTAGAATGTTTCTAGATATGG - Intergenic
1135641804 16:24126142-24126164 ATGAAAATGGTATCTAGATTGGG + Intronic
1136125660 16:28178411-28178433 ATGAAAAACTTAACTAGATATGG + Intronic
1140397367 16:74639837-74639859 ATGGAAAATGAAACTAGATAAGG - Intronic
1140422016 16:74827351-74827373 AAGAAAAATGGCTCTTGGTAAGG + Intergenic
1141288590 16:82695954-82695976 TTGATAAATGTGTGTAGATAAGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1142610072 17:1104293-1104315 AGGAACAATGTCTAGAGATAAGG + Intronic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1146520826 17:33524243-33524265 ATGCACAGTGTCTCTATATAAGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148519438 17:48256795-48256817 ATAAAAAATATTTCTAGAAATGG + Intronic
1148622967 17:49048553-49048575 AGGAATAATATGTCTAGATATGG - Intronic
1149206649 17:54255147-54255169 AAGAAAATTCTCACTAGATATGG + Intergenic
1149338949 17:55666830-55666852 ATGAAAAAGTACTCTAGATAAGG - Intergenic
1150002052 17:61447113-61447135 AAGAAAAAGGTCTCTGGATCAGG + Intergenic
1150918104 17:69456791-69456813 ATGAAAAACATCTCTAGATAAGG - Intronic
1151066746 17:71159504-71159526 ATCAAAAATGCCTCTTAATATGG + Intergenic
1153452075 18:5240732-5240754 ATGAAAAATGCCTGGAGATGGGG - Intergenic
1155708148 18:28841911-28841933 ATGAAAATTGTATCTAGATGTGG + Intergenic
1155720597 18:29006857-29006879 ATGAAAATTGTTTCAAAATATGG + Intergenic
1156694559 18:39751417-39751439 ATTCAAAATGTAGCTAGATAGGG + Intergenic
1157582473 18:48781568-48781590 AACAAAAATCTCGCTAGATATGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158319907 18:56251226-56251248 ATGAAGAGTGTCCCTAGAAAGGG + Intergenic
1158848611 18:61471194-61471216 AAGGAAAATGTTTGTAGATAAGG + Intronic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1159983631 18:74815970-74815992 ATGTAAAATGTATCTAAGTATGG + Intronic
1160466834 18:79084335-79084357 GTGAAAAAACTCTATAGATATGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
926039056 2:9658166-9658188 ATGAGAAATGTCTATAAACAAGG - Intergenic
928794437 2:34999060-34999082 ATGACAAATGTATCTGGCTAGGG - Intergenic
929296715 2:40256692-40256714 AAAAAAAATGTCTTTAGAGAAGG + Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929652818 2:43698847-43698869 TTTAAAAATATCTTTAGATATGG - Intronic
931206686 2:60153505-60153527 AAAAAAAATGCATCTAGATAAGG + Intergenic
933449693 2:82431823-82431845 ATAGAAAAAGTCTCTAGAGATGG - Intergenic
936747635 2:115598004-115598026 ATGAAATATGTCTCTATGTTTGG + Intronic
937048594 2:118868883-118868905 CTTAAAACTGTCTCTAGATCAGG + Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937760798 2:125601187-125601209 CTCCTAAATGTCTCTAGATATGG + Intergenic
937822733 2:126329269-126329291 ATAGAAAATGTCTCTATAAATGG + Intergenic
938001255 2:127740664-127740686 ATGAAAGATGTCTTAAGAAATGG + Intronic
938606650 2:132900403-132900425 AATAAAGATGTCTCTAGACATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939012914 2:136867691-136867713 ATGAAAGATATCTCTAGCAAGGG - Intronic
940495995 2:154429375-154429397 ACTAAAACTGTCTCTATATACGG - Intronic
940533259 2:154906149-154906171 ATGACAAATGTCATTATATAAGG - Intergenic
940689679 2:156899966-156899988 ATAAAAAATGTTCCTAGATTGGG - Intergenic
940938393 2:159526717-159526739 ATGAAACAAGCCTCTAGAGAAGG + Intronic
940952250 2:159688433-159688455 ATGAAAAATATCTTTATAAAGGG - Intergenic
941323214 2:164081563-164081585 AGGAAAAATGTCAGTAGAAAAGG - Intergenic
941588669 2:167390954-167390976 ATTTTAAATGACTCTAGATAAGG + Intergenic
942884123 2:180901602-180901624 ATGTAAAATGCCTCTCGGTATGG - Intergenic
943344668 2:186724432-186724454 AGGCAAAGTGTCTCTACATAGGG - Intronic
945044651 2:205771148-205771170 TTTAAAAATGCCTCTAGATGTGG + Intronic
945405175 2:209438232-209438254 ATGGAAACAGTCTGTAGATAAGG + Intronic
945459676 2:210091012-210091034 ATGAAAAATGTCTAAAGGAAAGG - Intronic
945626148 2:212208840-212208862 ATGAAAAATAACTCTGTATAAGG + Intronic
946629974 2:221656532-221656554 ATCAAAAATATTTCTAGAGATGG - Intergenic
947696205 2:232191848-232191870 ATGAAATATGACTATAGAAAGGG - Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948444931 2:238025240-238025262 ATGAAACAAGCGTCTAGATAGGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170798606 20:19571514-19571536 CTGAAAAATTTCTCCAGAGATGG + Intronic
1174601549 20:51729060-51729082 ATGAAAATTCTCTCTATAGATGG + Intronic
1176582121 21:8541137-8541159 ATGAAAAATGCTTTTAGAGATGG + Intergenic
1177342217 21:19818313-19818335 ATGGAAAATGTATCTAGAGTAGG + Intergenic
1178028826 21:28501515-28501537 ATGTCAAATGTCTCTGGTTATGG - Intergenic
1178722221 21:35020194-35020216 ATGAAAACTTTCTATAGAGAAGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179958376 21:44753826-44753848 ATGGAAAAAGTGTCTACATATGG + Intergenic
1180264956 22:10518185-10518207 ATGAAAAATGCTTTTAGAGATGG + Intergenic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182532623 22:30972221-30972243 AGGAGAAAAGTCGCTAGATATGG + Intergenic
1182674257 22:32025406-32025428 ATGAACAATGTTTTTAGAGATGG - Intergenic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1203237886 22_KI270732v1_random:23894-23916 AAGAAAAATGTATCGTGATAAGG + Intergenic
949588588 3:5468458-5468480 ATGAAAAATTTCTCAAAATAAGG + Intergenic
951171244 3:19544335-19544357 ATGAAAAATGTGTATGGACATGG - Intergenic
951785429 3:26413444-26413466 ATGAAAAATTTCTCAAATTAAGG - Intergenic
951928588 3:27937998-27938020 AGGAAAAATGGCTCTACCTAAGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952048268 3:29350375-29350397 ATGTAAAATTTGTCTAGACAGGG + Intronic
952395448 3:32916893-32916915 AGGAAAAATGGCTCTGGATTGGG + Intergenic
955063925 3:55518119-55518141 ATCAAAAATGTCTCAGGACATGG + Intronic
955201383 3:56855009-56855031 GTGGAAAAAGTCACTAGATATGG + Intronic
955223946 3:57045771-57045793 ATGCAAAATGGCCCTAGAAATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
956186094 3:66563414-66563436 ATGAAAAATTGCTCTAAATATGG + Intergenic
956707787 3:72014178-72014200 AATAAAAATACCTCTAGATAGGG + Intergenic
957117679 3:76047278-76047300 ATGAAAAATATAGCTAAATAGGG + Intronic
957315705 3:78573403-78573425 ATGAAAAATGGATGTAGAAAGGG - Intergenic
957709968 3:83843645-83843667 ATAAAAATTGCCTCTAAATAAGG + Intergenic
958145745 3:89622407-89622429 AAGAAAAATATCTTTAGATTTGG + Intergenic
959672415 3:108994279-108994301 CTTAAAAATGTCTATAGATTGGG + Intronic
960228487 3:115195871-115195893 ATGAAAAATAACTTTAAATAAGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960652474 3:119966709-119966731 ATAAAAAATCTATCTAGATAGGG - Intronic
960978025 3:123195484-123195506 ATGAAAAATGTCTTTCAATTAGG + Intronic
961127858 3:124437383-124437405 ATGAAAGATGTCTTTGGATAGGG - Intronic
962479277 3:135784865-135784887 ATGTTAAAGGTCTCTAGATAGGG - Intergenic
962721708 3:138181928-138181950 TTGAATAAAGTCTGTAGATAAGG - Intergenic
962728826 3:138260748-138260770 TTGAAAGAGGTTTCTAGATAAGG - Intronic
964054914 3:152442167-152442189 ATGAAAAATGCCTATAGTCATGG + Intronic
964066324 3:152584205-152584227 ATAACAAATGTCTCTGGCTATGG - Intergenic
964835593 3:160935010-160935032 AATATAAATGTATCTAGATATGG + Intronic
964903329 3:161687543-161687565 ATGAAAAATGTCAAGAAATATGG - Intergenic
965558905 3:170043499-170043521 CTGACAAATGTCTCTAGGTTGGG + Intronic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
970353155 4:15226533-15226555 GTGGCAAATGTCTCTATATAGGG + Intergenic
970436162 4:16037413-16037435 ATGTAAACAGCCTCTAGATAAGG + Intronic
970840350 4:20461509-20461531 ATGAGAAATGTGACAAGATATGG + Intronic
971188624 4:24405486-24405508 ATTAAAAATGGCTCTGTATATGG + Intergenic
971651409 4:29280200-29280222 CTGAAAAATGTCCATAGATTGGG - Intergenic
971696892 4:29916821-29916843 AGGAAAAATGTCTTTAAAAAAGG + Intergenic
976155174 4:82136294-82136316 ATGAAAAATGCCTTTAGACATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976373477 4:84317386-84317408 ATGAAAAGTGACTCTGGAAAAGG + Intergenic
976520334 4:86019342-86019364 ATCTTAAATGTCTCTAGAAAAGG + Intronic
977627967 4:99209089-99209111 TTCAAAAATATTTCTAGATATGG + Intronic
977662370 4:99605391-99605413 ATGAAAAAGATCTCTATGTAGGG - Intronic
978439845 4:108722045-108722067 ATGAAAAAAGTCTCTATGGATGG - Intergenic
978563350 4:110056561-110056583 ATGAAAATTATCTCTATAAAGGG + Intronic
978988377 4:115045625-115045647 ATGAAAAAGGTCTCCAGGGATGG - Intronic
979896182 4:126160926-126160948 ATGAAAAATGTACATAGATATGG - Intergenic
980398303 4:132245295-132245317 ATTCAAAATGTCCCTAAATATGG - Intergenic
981131930 4:141166781-141166803 ATGGAAAATATCTCAAAATAAGG + Intronic
982014307 4:151138176-151138198 ATGAAAAAAGTTTATAGACATGG + Intronic
982080767 4:151787273-151787295 ATGAAAAAAGTGACTAGTTATGG - Intergenic
982248022 4:153374445-153374467 ATGAAAAATGCTTCAAGAGATGG + Intronic
982797117 4:159659524-159659546 ATGAAAAATGTGTCTATTTGTGG + Intergenic
983657407 4:170097620-170097642 ATGAAATATGTCTCAACAGATGG - Intergenic
983757638 4:171360977-171360999 ATGGAAAATCTCTCTAGATCCGG + Intergenic
983901719 4:173142706-173142728 ATGCAAAATTTCTCTACAAAGGG + Intergenic
984080560 4:175244342-175244364 ATCAAAAATGTCTCACAATAAGG - Intergenic
984371227 4:178868637-178868659 ATGAAAAATGTCAAGATATAAGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985693628 5:1327414-1327436 ATGAAATATGTCTGTAGAGGAGG - Intronic
985693808 5:1328663-1328685 ATGAAATGTGTCTGTAGACAAGG - Intronic
987040307 5:14055953-14055975 ATGAAAAATGTCTCCAGGTGGGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988140205 5:27228727-27228749 ATGAAAGATGTTGCTAAATATGG + Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990972343 5:61522604-61522626 ATGGCAAATATCTCTAGACAAGG - Intronic
992355266 5:75975417-75975439 ATAAAATATGTCTATAGACATGG - Intergenic
992806989 5:80347145-80347167 TTTAAAAATGTTTATAGATATGG + Intergenic
994040402 5:95252813-95252835 ACAAAAAAAGTATCTAGATAGGG + Intronic
994154367 5:96486352-96486374 ATGACAACTGTTTCTAGATCTGG - Intergenic
995097745 5:108259251-108259273 ATAAAAAATGTCTATCGATATGG + Intronic
995421019 5:111967006-111967028 AATAAAAATGTCTTTAGACATGG - Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
998937577 5:147247038-147247060 ATTAAAAATGTCTATAGCTTTGG - Intronic
999551753 5:152695152-152695174 GGGAAAAATGTCTCCACATAGGG - Intergenic
999812271 5:155138943-155138965 ATGAAAAATATCTCTATCTTAGG - Intergenic
1000217169 5:159171384-159171406 GTAAAAAATGTTTCTAAATATGG - Intronic
1000501234 5:162053578-162053600 ATGAAGAATGACTCTTCATAAGG - Intergenic
1000846157 5:166282851-166282873 TGGAGAAATGTCTCTAGACATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002809069 6:608381-608403 TTAAAAAATGTTTCTAGAAAAGG + Intronic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004890688 6:20097663-20097685 ATGAAATGTGTCTCCAGCTATGG + Intergenic
1005601087 6:27426596-27426618 ATGAAATAAGTCACTAGAAAAGG - Intergenic
1006660911 6:35643461-35643483 ATGAAAAATGACCCTACAGAAGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1006791591 6:36704627-36704649 ATGACAAATGTTTCTGGAAAAGG - Intronic
1008445087 6:51579729-51579751 AGGAAAAATGTCTCTACATCAGG - Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1009904433 6:69851422-69851444 ATGAAAGATGCCTATAGATGTGG - Intergenic
1009907298 6:69885564-69885586 AGGATAAATGTATCTAGAGATGG - Intronic
1010054721 6:71551882-71551904 ATGAAATATGTCACTAGTGAAGG + Intergenic
1010466611 6:76174570-76174592 ATGGAAAATGACTCAAGACAAGG + Intergenic
1010714528 6:79212982-79213004 ATAAAAATGGTTTCTAGATAAGG - Intronic
1011604622 6:89090934-89090956 ATGAAGAATGTCGCCAGGTACGG + Intergenic
1011719687 6:90142657-90142679 ATGAAATATGTCTGAATATAAGG - Intronic
1012084218 6:94802974-94802996 ATGGAAAAATTCTCTAGAAATGG + Intergenic
1012773034 6:103465201-103465223 ATTAGAACTGTCCCTAGATATGG + Intergenic
1013729137 6:113142347-113142369 ATGATAATTGTGTCTAGACATGG - Intergenic
1015483100 6:133737168-133737190 ATTAAAGATTTGTCTAGATATGG - Intergenic
1016173977 6:141055030-141055052 ATGAAAACTGTCTGTTAATATGG - Intergenic
1016850410 6:148613225-148613247 AGGAAAAATGTCACTGGATAAGG + Intergenic
1018565883 6:165152839-165152861 ATGAAAAATGTTTTTAAATTTGG - Intergenic
1020599984 7:10262350-10262372 TTTAAAAATGCCTATAGATATGG + Intergenic
1020812926 7:12867800-12867822 AAGAAAAGTGTCTGGAGATATGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023495675 7:40793612-40793634 ATGTAAGATGTATCTAGGTATGG + Intronic
1024239639 7:47424431-47424453 AAGAATAATATCTTTAGATAAGG - Intronic
1024432849 7:49310336-49310358 ATGAACAATGTCTACAGAAAAGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1028612991 7:92732999-92733021 ATGAAAAGTGGATCCAGATAAGG - Intronic
1028947931 7:96601830-96601852 ATGAAAAATGATGCTGGATAGGG + Intronic
1028986357 7:97012115-97012137 ATGAAAAATTACTCTAATTATGG - Intergenic
1029236194 7:99121461-99121483 CTGAAATCTGTCTATAGATATGG - Intronic
1030094163 7:105882964-105882986 ATGAAAAATGCCTTTAGACCTGG - Intronic
1030224631 7:107136126-107136148 CTGAAAAATGAATCTAGAAATGG + Intronic
1030574540 7:111269325-111269347 ATGAATAATGTCTTTCTATATGG - Intronic
1030848648 7:114455344-114455366 ATGGCAAATGGTTCTAGATATGG - Intronic
1031965900 7:128028235-128028257 AAGAAAGATGTCTGTAGAAATGG + Exonic
1033167890 7:139057183-139057205 AAAAAAAATGTTTCTAGAGATGG - Intronic
1033822306 7:145149098-145149120 ATCTAAAATGACTCTAGAGAAGG - Intergenic
1033858652 7:145597300-145597322 TAGCAAAATGTCTCTAGCTAGGG - Intergenic
1033903265 7:146169380-146169402 ATGAAAAATGTCTATATTGAAGG + Intronic
1034013721 7:147559044-147559066 TTTAAAAATGTCTGTAGAGATGG + Intronic
1035890836 8:3340993-3341015 ATCAAAAATGTCTGTAGAATTGG + Intronic
1036970639 8:13351036-13351058 ATGAAAACTGTCCCTAAATTAGG - Intronic
1038133827 8:24764666-24764688 ATTTAAAATATATCTAGATACGG + Intergenic
1039412815 8:37369657-37369679 ATGAAAAATGTTTTTAATTAGGG - Intergenic
1039674299 8:39643331-39643353 CTTAAAAGTGGCTCTAGATAAGG - Intronic
1040068512 8:43169466-43169488 GTGAAAAATGTCTCTACCTCAGG - Intronic
1040831966 8:51687255-51687277 ATGACAAATTTCTTTAGAGAAGG - Intronic
1042807147 8:72783361-72783383 ATGAAAAAAGTCTGGAGAGAGGG - Intronic
1043246828 8:78013790-78013812 ATGCATAATGTCTCTAGAAAAGG - Intergenic
1043259739 8:78181336-78181358 ATGAAAAATTTGATTAGATAGGG + Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043599700 8:81922687-81922709 ATGGAATATTTCTGTAGATATGG - Intergenic
1043710250 8:83407483-83407505 AGGAAAAATGTCTCCAATTATGG - Intergenic
1044426734 8:92060442-92060464 ATAAAAAAAGGCCCTAGATATGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047346767 8:124036594-124036616 ATGAAAACTCTCTCAAGGTATGG - Intronic
1047899281 8:129402365-129402387 ATCAAAATTGTGACTAGATATGG - Intergenic
1048937939 8:139372462-139372484 ATGAAAACTGTCTTTATAAAAGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050839233 9:10125891-10125913 ATGTAAAATGTCTAAAGATATGG + Intronic
1052130665 9:24842655-24842677 AAGAAAAATGAATCTAGACACGG - Intergenic
1055308818 9:74957005-74957027 ATAAAAAATGCATTTAGATAGGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1057454291 9:95193542-95193564 ACTAAAAATGTCTCTAAATGGGG + Intronic
1057754310 9:97819627-97819649 AAGAAAAATATCTGTAGTTAGGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1203582032 Un_KI270746v1:16683-16705 AAGAAAAATGTATCGTGATAAGG + Intergenic
1203612138 Un_KI270749v1:19154-19176 ATGAAAAATGCTTTTAGAGATGG + Intergenic
1185730673 X:2458847-2458869 ATGAAAAAATTAGCTAGATATGG + Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187274807 X:17807869-17807891 CTGAAAATTTTCTCAAGATATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188232226 X:27678859-27678881 ATGAAAAATGTATGTAGATCTGG + Intronic
1188281120 X:28270863-28270885 ATCAAAAATGTTCCTAGATTAGG - Intergenic
1189022738 X:37358425-37358447 AAAAAAAATGAATCTAGATATGG - Intronic
1189747750 X:44187614-44187636 TTTAAAAATGTCTGTAGAGACGG - Intronic
1190431408 X:50381169-50381191 TTGAAAAATGGCTCTAGATCCGG + Intronic
1190785103 X:53638966-53638988 ATGAAAAGTGACTTTGGATATGG - Intronic
1192309799 X:70001335-70001357 ATGCAACATGGCTCTAGATTGGG - Intronic
1194221909 X:91204846-91204868 ATGAAAAATGTGTCTATAAAGGG - Intergenic
1194419362 X:93653676-93653698 ATGAAAAATGTCACAGAATATGG - Intergenic
1194483015 X:94450342-94450364 AAGAAAATTTTCTCTAGTTAAGG + Intergenic
1194972665 X:100361371-100361393 AAGAAGAATGTTTTTAGATAGGG + Intronic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198504404 X:137287204-137287226 ATGAAAAATCAATCCAGATATGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200302957 X:154996816-154996838 ATTATAAATATCTCAAGATAGGG - Intronic
1200558431 Y:4668611-4668633 ATGAAAAATGTGTCTATAAAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201475790 Y:14379467-14379489 ATGAAAAGTATATGTAGATAAGG + Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic