ID: 924164814

View in Genome Browser
Species Human (GRCh38)
Location 1:241270515-241270537
Sequence TTGTGTCAGCCATGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924164814_924164818 13 Left 924164814 1:241270515-241270537 CCATATTCCCATGGCTGACACAA 0: 1
1: 0
2: 3
3: 15
4: 159
Right 924164818 1:241270551-241270573 TTTCTCCATCCTGATGTCCTTGG 0: 1
1: 0
2: 1
3: 32
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924164814 Original CRISPR TTGTGTCAGCCATGGGAATA TGG (reversed) Intronic
901732364 1:11289490-11289512 ATGTGACAGCCATGGAGATAGGG + Intronic
903727405 1:25460604-25460626 TTGTGTCAGCCTGGGCAACATGG - Intronic
904220955 1:28968549-28968571 TTTTCTAAGCCCTGGGAATATGG - Intronic
905850595 1:41271436-41271458 TGGGGTCAGCCAAGGGAATGTGG + Intergenic
912158663 1:106953719-106953741 TTGTGATAGCCTTGGGGATACGG - Intergenic
913670245 1:121091241-121091263 TGGTGTCAGCCATATGATTAGGG - Intronic
914022012 1:143878683-143878705 TGGTGTCAGCCATATGATTAGGG - Intergenic
914660494 1:149786611-149786633 TGGTGTCAGCCATATGATTAGGG - Intronic
918584125 1:186166210-186166232 TTGTGGCAGCTATGGGAGCAGGG - Exonic
921722353 1:218487310-218487332 TTGTGTCTGGCTTGGGAAAATGG + Intergenic
923285858 1:232494465-232494487 TTGTTTCAGCCATGGGAACATGG + Intronic
924164814 1:241270515-241270537 TTGTGTCAGCCATGGGAATATGG - Intronic
924946673 1:248851176-248851198 TGGAGTCAGCGATGGGAATTAGG + Intronic
1065232828 10:23616088-23616110 TTGTGTCATCCATGGTAATTAGG - Intergenic
1066231300 10:33436377-33436399 TGGTGTCAGCCATGGTATTCTGG - Intergenic
1070240546 10:74675895-74675917 TTATGGCAGCTGTGGGAATATGG + Intronic
1071325366 10:84510548-84510570 TTGTCTTAGCCATGAGGATATGG + Intronic
1072029069 10:91499632-91499654 TTGTCTTAGCCATGTGAATATGG + Intronic
1075540264 10:123306892-123306914 TTCTGTGCGTCATGGGAATAGGG + Intergenic
1078083933 11:8222662-8222684 TTGTGTGAGCCATGGGTCCAAGG - Intergenic
1078325563 11:10378146-10378168 TTGTGTCAGCCATGGTTATTTGG + Intronic
1080739693 11:35052278-35052300 AGGTGACAGCCATGGGAAGAGGG + Intergenic
1081738737 11:45423472-45423494 TTGGGTCAGCCTTGGGCAGATGG - Intergenic
1084297912 11:68225191-68225213 TTCTGCCAGTCATGGGATTAGGG + Intergenic
1084678251 11:70649442-70649464 GTTTGTCAGCCCTGGGAATTAGG - Intronic
1085602473 11:77867715-77867737 CTGTGTCAGCAAAGGGGATATGG - Intronic
1088767864 11:113002069-113002091 TTGTTTCAGAAATGGGAATCTGG - Intronic
1089105493 11:115999997-116000019 GTGTGGAAGCCATGGGAACAGGG + Intergenic
1089713019 11:120330545-120330567 TTAAGTCAGCCATGGGAACCAGG + Exonic
1090340194 11:126011363-126011385 TTTTGTCAGACATGGGAAGGAGG - Intronic
1090415607 11:126538206-126538228 TTGTGTCAGCCATGCAAAAAGGG + Intronic
1090609212 11:128455277-128455299 TTCTGCCTTCCATGGGAATAAGG - Intergenic
1090852669 11:130584177-130584199 TTATATCAGCCATTGGAATGGGG + Intergenic
1091379374 12:46143-46165 GTGTGTCAGCCAGGGGCATCTGG - Intergenic
1091901443 12:4147303-4147325 TTGTGGCAGGCATGGGACTGAGG - Intergenic
1092794251 12:12094525-12094547 TGGTGTCAACCAAGGGAATGGGG - Intronic
1095302669 12:40604057-40604079 TAGTGTGTACCATGGGAATATGG - Intergenic
1095443622 12:42262781-42262803 TTGTTTCAGGCATGATAATATGG - Intronic
1098276668 12:68819173-68819195 TTTTTTCATCCTTGGGAATAAGG - Intronic
1099805024 12:87507871-87507893 CTTTGTCAGTCATGGGAAGAAGG - Intergenic
1100350814 12:93780549-93780571 ATGTGACAGGCATGGGAATCAGG - Intronic
1100640319 12:96476236-96476258 TTTTGCAAGCCATGGGGATATGG + Intergenic
1101541674 12:105671178-105671200 ATGTGTCAGCCAAGTGAATAAGG + Intergenic
1101681480 12:106971261-106971283 CTGTGCCTTCCATGGGAATAGGG + Exonic
1103855673 12:123969133-123969155 TTTTATCAGCAATGGGAATAAGG - Intronic
1106578245 13:30996120-30996142 TTCTGTCAGCCAGGGAAAGATGG + Intergenic
1107352834 13:39533750-39533772 TTGCTTCAGACATGGAAATATGG - Intronic
1108004180 13:45931019-45931041 TTGGGTCAGGAATGGGGATAAGG + Intergenic
1109205358 13:59477373-59477395 GTGTGTCAGAAATGAGAATACGG - Intergenic
1109463860 13:62701286-62701308 TTGTGTAAGGATTGGGAATATGG - Intergenic
1110463373 13:75772715-75772737 ATCTGTCAGACATGGTAATAAGG + Intronic
1111475167 13:88736460-88736482 TTGTTTGATACATGGGAATATGG + Intergenic
1112371158 13:98794805-98794827 TTGTGTCACACATGGCAACATGG - Intronic
1114802855 14:25797976-25797998 CTATGTCAGCCTTGGGAAGAGGG - Intergenic
1119709158 14:76809019-76809041 TTGAGTGAGCCAAGGGAACAGGG - Intronic
1119954248 14:78778184-78778206 TTGTGTGAGTCATGAGAAGAAGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1128017045 15:64356545-64356567 CTGGGTCAGCCACGGGATTAAGG - Intronic
1130354031 15:83113842-83113864 TCATCTCAGCCATTGGAATATGG - Intronic
1132826133 16:1906590-1906612 ACGTGCCAGCCAAGGGAATAAGG + Intergenic
1133618748 16:7505714-7505736 GTTTGTCAGCCATGGCAAGATGG + Intronic
1135075272 16:19387815-19387837 TTGTGTATGCCCTGTGAATAGGG - Intergenic
1135391977 16:22101278-22101300 CTGTGTCATCCAAGGGACTATGG - Intronic
1137491438 16:48936482-48936504 TTTTGTCACTCAAGGGAATAGGG - Intergenic
1142334488 16:89478779-89478801 TGATGTTAGTCATGGGAATAAGG - Intronic
1144406601 17:14957997-14958019 TTGTGACAGCAGTGGGAAGAAGG - Intergenic
1147683520 17:42271729-42271751 TGGTGTCATCCATGTGAAAATGG + Intronic
1149355234 17:55832661-55832683 ATGTGTCAGCCATAGCATTAGGG - Intronic
1153314409 18:3707953-3707975 TTGTTTCATCCATGAGAAAATGG + Intronic
1155084686 18:22446528-22446550 TTGGGTCACCCATGGCAACAGGG + Intergenic
1158182630 18:54734286-54734308 TTGTCTAAGCCATGAGAATTTGG + Intronic
1160107645 18:75993477-75993499 TTCTGGCAGCCATGGGAAATGGG + Intergenic
1160315230 18:77837943-77837965 TTGCGTCAGCAATGGGAAGAAGG + Intergenic
1168571731 19:57476430-57476452 TTCTGCCAACCATTGGAATAAGG - Intronic
925054226 2:843744-843766 TTTTGTCAGCTTTGGGAATTTGG + Intergenic
928203296 2:29265375-29265397 TTTCGTCAGACATGGGATTAGGG - Intronic
928651252 2:33405855-33405877 TTGTGCCAGCCCTGGGAATATGG + Intergenic
929112024 2:38413086-38413108 TGGTGTCAGAAATGGGAATGTGG + Intergenic
929571413 2:43025438-43025460 GTGAGTCAGCCATGGGCATGTGG - Intergenic
930843024 2:55869057-55869079 TTCTATCAGTCATGAGAATAAGG + Intronic
931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG + Intergenic
931620461 2:64204891-64204913 GTGTGTCAGCCATGGCACTGGGG + Intergenic
932281840 2:70499690-70499712 TTGTGTCAGACATTGCACTAGGG + Intronic
932565432 2:72903903-72903925 TTGTGTCTGCCATGGGCATAGGG - Intergenic
933379944 2:81529585-81529607 TTGTGACTGAGATGGGAATATGG + Intergenic
935714541 2:105928340-105928362 TTGTTTCACTCATGGGAAAATGG - Intergenic
936564393 2:113571784-113571806 GTGTGTCAGCCAGGGGCATCTGG + Intergenic
937449464 2:121989860-121989882 CTGGGCCAGCCCTGGGAATAGGG + Intergenic
938295191 2:130173624-130173646 TTCTACCAGCCATGGGAAGATGG + Exonic
940092460 2:149936285-149936307 TTGTGTGCTCCATGGGATTAAGG - Intergenic
941230654 2:162907720-162907742 TTGTCTCAGCAATTGGAACATGG + Intergenic
941659928 2:168185735-168185757 TTGTGTGAGTCATGGGAGTAGGG - Intronic
941810269 2:169748643-169748665 TTGTCACAGCCCTGGGAAGAAGG + Intronic
943142663 2:184001972-184001994 TTATGTCAGCCAAGGGCCTAAGG - Intergenic
944641243 2:201727990-201728012 GAGTGTCAGCCATGTGAAGAGGG - Intronic
947346981 2:229201958-229201980 TTGTGGGAGCCATAGGAATGTGG - Intronic
948886040 2:240885378-240885400 TTATCTTGGCCATGGGAATAGGG + Intergenic
1169676539 20:8160531-8160553 TGGTGTCAGCCAAGAGAAAAGGG + Intronic
1169934735 20:10871160-10871182 TTGTGTGCGTCATGGGATTAGGG + Intergenic
1171190847 20:23158227-23158249 TTGTTTCAGCCATGGGTTTATGG - Intergenic
1171200265 20:23235023-23235045 TTGTTTCAGCCAGTGGAATGAGG - Intergenic
1171388769 20:24787478-24787500 TTGTGTCAGGGAGGGGAAGAAGG - Intergenic
1172423132 20:34834741-34834763 TTGTGTCAGCCCAGGAATTAGGG + Intergenic
1173050325 20:39553276-39553298 GTGTGTCAGCAATGGAAATGAGG + Intergenic
1173593786 20:44246048-44246070 TTGTGGCAGCCAAGGCAAAAAGG + Intergenic
1180963048 22:19771028-19771050 CTGTGTCAGCCATGGGCACGGGG + Intronic
1181364473 22:22364484-22364506 TTGTGTCTTCCAGGGGAAAAGGG - Intergenic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183741374 22:39670414-39670436 TGGTGTCAGCCATTGGACTCTGG - Intronic
949254525 3:2030066-2030088 ATGTGGCAGCCATGTGAAGATGG + Intergenic
950250469 3:11461130-11461152 TTGTGGAAGCCATGGATATAGGG + Intronic
951525433 3:23648466-23648488 TTGTGGCAGCCATGGGATTTGGG + Intergenic
952962165 3:38599070-38599092 TTGCGTCAGCCTGGGGAAAAGGG + Intronic
953629689 3:44602765-44602787 TGGTGTCAGGCATAGAAATATGG + Intronic
957030254 3:75232397-75232419 CTGTTTCAGCCATAGCAATATGG + Intergenic
957158188 3:76573200-76573222 TTGTATCAGCCATGTGATTTGGG + Intronic
959239546 3:103771902-103771924 TAGTGATAGCCAGGGGAATATGG + Intergenic
960871824 3:122257475-122257497 TTGTGCCAGAGATGGGAATATGG - Intronic
961986708 3:131142204-131142226 TTGCTTCAGCCAGTGGAATATGG - Intronic
962586361 3:136846234-136846256 TTTTCTCAGCCATAGGAATGAGG + Intronic
963772325 3:149400280-149400302 TTCTGTCATTCATGGCAATATGG + Intergenic
964854708 3:161134141-161134163 TTCTGTCATTCATGGCAATATGG - Intronic
971163105 4:24154495-24154517 TTGTGTAAGCCATGGTAGTCTGG + Intergenic
973644504 4:52936421-52936443 TTGTCTCTGCCATTGAAATATGG + Intronic
976631107 4:87237140-87237162 CTGTGTCAGGCCTGAGAATATGG + Intronic
977253268 4:94711928-94711950 TTGTGGCAGCCATGGAGAGATGG + Intergenic
980946521 4:139326053-139326075 TTGTGTCTGCAATGAGATTATGG + Intronic
981567074 4:146113203-146113225 CTGCGGCAGCCATGGGAATGTGG - Intergenic
982155413 4:152515474-152515496 TTGTGACTGCCATGGGCAAATGG - Intronic
984788625 4:183592843-183592865 TGGTGGCAGCCATGAGAAAAAGG + Intergenic
986244873 5:5998147-5998169 TTGTTTCAGCCATGGCAGGATGG + Intergenic
997479252 5:134171341-134171363 TTGTGGAAGCCAAGGGAAAAGGG - Intronic
997640885 5:135448246-135448268 TCGAGTCAGCCAGGGGAACAGGG + Exonic
999455088 5:151708584-151708606 GTGTGTCTGCCAAGGGAATTTGG - Intergenic
1001004736 5:168040126-168040148 TTGTGTCTGCCATGAGAACAAGG - Intronic
1001486145 5:172120909-172120931 ATGTGTCAGGCATGAGGATAAGG + Intronic
1005886727 6:30102717-30102739 TTGTCTTAGACATGGGAATTAGG - Intergenic
1007786164 6:44280643-44280665 TTGGTTCAGCCATGGGCATGTGG + Intronic
1009598019 6:65761295-65761317 TAGTTTCAGCCACTGGAATAGGG + Intergenic
1014004276 6:116399148-116399170 GTCTGTCAGCCAAGGGAACATGG - Intronic
1014471810 6:121824831-121824853 TTGTGTCAGACATTGGAGAATGG + Intergenic
1015099276 6:129455991-129456013 TTATGTAAGCCATAGGAAAAAGG + Intronic
1017010433 6:150059665-150059687 TTGAGTCCTCCATGGAAATAAGG + Intergenic
1018059388 6:160078790-160078812 TTGTGGCAGCTTTGGGAAGAGGG + Intronic
1018434233 6:163746773-163746795 ATGTGTCAGGCACTGGAATAGGG - Intergenic
1019127803 6:169852510-169852532 ATGTGTCAGCCTTGGGAATGTGG - Intergenic
1022704677 7:32791094-32791116 TTGTGTGAGCCATTGGCTTAAGG - Intergenic
1022910009 7:34891695-34891717 TTGTGTGAGCCATTGGCTTAAGG - Intergenic
1023243923 7:38179849-38179871 CTGAGTCAGCCATGAGAAAATGG + Intronic
1025153119 7:56576047-56576069 CTGTTACAGCAATGGGAATATGG - Intergenic
1025764258 7:64428092-64428114 CTGTTACAGCAATGGGAATATGG + Intergenic
1026567599 7:71502362-71502384 TTATCTCAGCCAATGGAATATGG + Intronic
1026675592 7:72425447-72425469 TGGTCTCAGCCATGGGCACATGG - Intronic
1027745721 7:82071454-82071476 TTTGGGCAGCAATGGGAATAGGG + Intronic
1031537259 7:122950602-122950624 TTCTGTCATTCATGGCAATAGGG - Intergenic
1033035826 7:137875383-137875405 TAGTGTAAGCCATGGGTACATGG + Exonic
1033398230 7:140995881-140995903 TTGTTTCAGCCTTGGCCATAGGG + Intergenic
1033735660 7:144218947-144218969 GTGTGTCAGACATGGGATTGAGG - Intergenic
1033747392 7:144332022-144332044 GTGTGTCAGACATGGGATTGAGG + Intergenic
1034545049 7:151784137-151784159 TTGTCTCAGCCCTGGGAACGAGG - Intronic
1035390546 7:158501471-158501493 TTGTGTCGGGGATGGGAACAGGG - Intronic
1035793190 8:2326308-2326330 GTCTGTCAGCGATGGGAAGATGG + Intergenic
1035799614 8:2395397-2395419 GTCTGTCAGCGATGGGAAGATGG - Intergenic
1037735655 8:21563905-21563927 GTGTGTCAGCCATGGAAGAAGGG + Intergenic
1039455399 8:37702530-37702552 TTGTGGCAGCCATGGGAGGAAGG + Intergenic
1048508785 8:135043905-135043927 TTGTCTCAGCCATGTTAAGATGG + Intergenic
1060462248 9:123867823-123867845 TAGAGTCAGCCTTGGGACTATGG + Intronic
1187621434 X:21060876-21060898 TTGTGGCTGCCTTTGGAATATGG - Intergenic
1188364085 X:29293060-29293082 GTGTCTCAGACATGGAAATATGG - Intronic
1188479493 X:30622600-30622622 TTTTGTCTGCTATGGGAAAATGG - Intergenic
1190063880 X:47227235-47227257 TTGGGTCAGCCTTGGGGGTATGG + Intronic
1190543493 X:51501394-51501416 TTGTGACAGCAATGTGAAGAAGG + Intergenic
1190663070 X:52672868-52672890 TTGTGATAGACATGGGAAAAAGG - Intronic
1190676353 X:52785614-52785636 TTGTGATAGACATGGGAAAAAGG + Intronic
1198065383 X:133091339-133091361 TTGTTTCAGGTATGAGAATATGG - Exonic
1198405934 X:136312423-136312445 TTGAGACAGCCTTGGCAATATGG + Intronic
1198960294 X:142175432-142175454 TGCTGTCAGCCCTGGGAAAAGGG - Intergenic
1201456312 Y:14170753-14170775 TTGTGTCAGCCATTAGAGGAAGG + Intergenic