ID: 924165235

View in Genome Browser
Species Human (GRCh38)
Location 1:241274460-241274482
Sequence CTCTAACACAACTATGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924165235 Original CRISPR CTCTAACACAACTATGTACA TGG Intronic
901060252 1:6468541-6468563 CTCTACCACAACCATGGCCAGGG + Exonic
904219089 1:28950092-28950114 CACTAACACACACATGTACAAGG - Intronic
906565998 1:46801503-46801525 CTCTAACACAACTGTCTGAAGGG + Intronic
916537864 1:165721519-165721541 ATCTAACTCAACCATGTAAAAGG + Intergenic
917501565 1:175590584-175590606 CTATAATAGAACTATGTGCAAGG + Intronic
918246657 1:182666426-182666448 CCCTCACACAACTATGTAATGGG - Intronic
919428881 1:197468769-197468791 CTCTTACACAGCAATGTCCAGGG - Intronic
921694551 1:218192547-218192569 ATCTAACACCACTAAGTAAATGG - Intergenic
924165235 1:241274460-241274482 CTCTAACACAACTATGTACATGG + Intronic
1068028561 10:51679648-51679670 CTATCACAGAACTATGTAAATGG - Intronic
1072250305 10:93577072-93577094 CTTTAAAACAAATATGTACAGGG + Intronic
1072962185 10:99939396-99939418 CTCTAGCACAGCTCTGTAGATGG + Intronic
1074794382 10:116926582-116926604 CTCCCACACAACTATGAAAATGG - Intronic
1077449439 11:2628078-2628100 CTGTAACACTACAATGAACATGG + Intronic
1083016430 11:59458836-59458858 CTGTAAGTCAAATATGTACATGG + Intergenic
1085688653 11:78648296-78648318 ATCTAACAAACCTGTGTACAAGG + Intergenic
1087852694 11:103050878-103050900 CTCTAATAAAAGTATATACAAGG + Intergenic
1088141902 11:106627173-106627195 CTCTAGCACCAATATGAACATGG + Intergenic
1088682183 11:112252955-112252977 ATCTAACACATGTATGAACAAGG - Intronic
1089334018 11:117710109-117710131 CTCTAACACCACTTTGTTTATGG + Intronic
1092036081 12:5335998-5336020 CTCCATCACATCTATGTTCATGG - Intergenic
1094253400 12:28393326-28393348 CTCTAAAACAACTGTGGATACGG - Intronic
1100285967 12:93166916-93166938 CTTTAACACACCTATGTACACGG + Intergenic
1100892818 12:99145117-99145139 CTCCAAGAGAAGTATGTACAAGG + Intronic
1101366782 12:104079256-104079278 ATCAAACACTACTATGTACCAGG - Intronic
1102201125 12:111058677-111058699 CTGTAACACCACTATCTGCAAGG - Intronic
1106748791 13:32734846-32734868 CTCTAACACATTCATGTATATGG + Intronic
1111166677 13:84466593-84466615 CTTTCACACATGTATGTACAGGG + Intergenic
1112779671 13:102885341-102885363 CTCTAAAATAACTATGTGCATGG + Intergenic
1116350454 14:43855794-43855816 CTATAACAAATCTATGGACATGG - Intergenic
1121186518 14:91976635-91976657 ATCTAACACAACTAAGACCATGG + Intronic
1121848702 14:97198826-97198848 GTCTAGCACAAGTCTGTACAGGG + Intergenic
1126238127 15:46409423-46409445 CACACACACAACAATGTACAAGG + Intergenic
1129679174 15:77648386-77648408 CACTCACACAACCATGCACATGG + Intronic
1130633313 15:85591917-85591939 CTCAAGAACAACTATGTTCAAGG + Intronic
1131494331 15:92892299-92892321 CTCTAACACTATTATAAACATGG + Intronic
1131681317 15:94726522-94726544 CTCAAAAACACCTATGTAAAAGG - Intergenic
1132083860 15:98890670-98890692 CTGTAACACACCTATGTTCTTGG + Intronic
1133743458 16:8669303-8669325 AACTAGTACAACTATGTACAGGG + Intergenic
1138710505 16:58965487-58965509 CTCTAAAATATGTATGTACAGGG - Intergenic
1138912432 16:61417538-61417560 CTCTAATTTAACTATGTATAGGG - Intergenic
1140675977 16:77330207-77330229 CTCTAACACAACTTAGCTCATGG - Intronic
1141319291 16:82991801-82991823 CTCTTCCTCAACTATGTTCAAGG - Intronic
1141803899 16:86329912-86329934 CTCACTCACAACTTTGTACACGG + Intergenic
1149188052 17:54024934-54024956 CCATAACACAAATATGTAAAAGG + Intergenic
1149875745 17:60231233-60231255 TTGTAACATACCTATGTACAGGG - Intronic
1152166841 17:78714483-78714505 CACAAACACAACAGTGTACAAGG - Intronic
1153618771 18:6956865-6956887 CTCTAAGAGAAATATATACATGG - Intronic
1155148895 18:23106681-23106703 CTCTAACACAACTGGGTCCCTGG + Intergenic
1168571458 19:57474495-57474517 GTCTAACACAACTAAGACCAAGG + Intronic
931322823 2:61188503-61188525 CTTTAACAGAACTATTTTCAGGG + Exonic
939063633 2:137455427-137455449 ATCTAACACAACAATGTAAATGG + Intronic
941066814 2:160912754-160912776 TTGAAACACAAATATGTACAAGG - Intergenic
941377135 2:164745621-164745643 CTCTAACACAGGTATGCAGATGG + Intronic
946267572 2:218560575-218560597 CACTAACTCAACTATCTATAGGG + Intronic
947411573 2:229846451-229846473 GTCTAAAAAAACAATGTACATGG - Intronic
948135076 2:235630510-235630532 CTTTAAAAAAACAATGTACAGGG - Intronic
948199529 2:236119747-236119769 CTCTCACACACCGATGCACAGGG - Intronic
1169129423 20:3157563-3157585 CTCTAACAGAATCATCTACAGGG - Intronic
1175353453 20:58343266-58343288 CTCTCACTCACCTATTTACATGG + Intronic
1178461887 21:32809951-32809973 ATCTAACACGACTAGGTACTAGG - Intronic
1181829698 22:25550324-25550346 CTCTATCAACACAATGTACAGGG - Intergenic
1182140117 22:27947540-27947562 AGCTAATACAACTATGTTCAAGG - Intergenic
1182143130 22:27979929-27979951 ACCTAAAACAACGATGTACATGG + Exonic
1185029743 22:48435715-48435737 CACACACACAAGTATGTACATGG + Intergenic
955825258 3:62939450-62939472 CTCTAACACTACCATGTTAATGG - Intergenic
956064630 3:65384378-65384400 CAGTATCACAACTATTTACATGG + Intronic
957173053 3:76764801-76764823 CTGTAACAGAAGTATGTACAGGG - Intronic
958842090 3:99218475-99218497 ATCTAACACTACTATGTTCTAGG + Intergenic
959129032 3:102329178-102329200 CTTTAAAACAATTATGTGCATGG - Intronic
961596024 3:128017409-128017431 CTTTAACAAAACTTTGTAAAGGG + Intergenic
963949473 3:151182965-151182987 CACTTACACAACTATGTGCTAGG - Intronic
963965411 3:151363412-151363434 CTCTCACACAACTGTGTGAATGG - Intronic
964142937 3:153423873-153423895 CAAAAACACAACTAAGTACATGG + Intergenic
964209855 3:154214630-154214652 CTCTGATCCAACTATCTACACGG - Intronic
964940190 3:162150649-162150671 CTCTCGCACAACTTTGTACTGGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967430310 3:189376517-189376539 CACACACACAATTATGTACATGG - Intergenic
967638127 3:191829601-191829623 CTTTCCCACAACAATGTACAAGG - Intergenic
967647836 3:191948029-191948051 CTCTAACAAATCTAGGCACAGGG + Intergenic
974260074 4:59516366-59516388 ATATAACACAACTATCTACAAGG - Intergenic
977955703 4:103023336-103023358 CTCTGACATAAGTATGTATAAGG + Intronic
978138441 4:105290801-105290823 CTTTATAACAACTATATACATGG + Intergenic
982845823 4:160251108-160251130 ATCTAACACAAATTTTTACAGGG - Intergenic
983019078 4:162652672-162652694 CTCCAATACAATTATATACATGG + Intergenic
987265287 5:16246994-16247016 CTCTCTCTCAACAATGTACAGGG + Intergenic
990112622 5:52346702-52346724 GTGTAAAACATCTATGTACATGG - Intergenic
990685639 5:58297660-58297682 CTCTAACACAATTATATCCCTGG - Intergenic
990958927 5:61372623-61372645 CTCTCAAACCACTATGTACCAGG + Intronic
998602191 5:143596227-143596249 TGCTAACAAAACTATTTACATGG - Intergenic
1000061182 5:157656968-157656990 CTTTAACAAAAATATGTAAAGGG + Intronic
1008121088 6:47617584-47617606 CTAGAAGAGAACTATGTACAAGG - Intronic
1011229039 6:85139277-85139299 CTCTAACAGAAATAGGGACATGG - Intergenic
1013683354 6:112549592-112549614 CTCTAACAAGACTATATCCATGG + Intergenic
1018300465 6:162396995-162397017 CTCCAACACCACTATGGCCATGG - Intronic
1019084184 6:169458506-169458528 TTCAAAAACAACTATGTACTTGG + Intronic
1026482651 7:70791373-70791395 TTTTTACATAACTATGTACACGG - Exonic
1027719762 7:81725385-81725407 CTCTTACACATATATGTGCATGG + Intronic
1032861616 7:135885171-135885193 TTCTAACACATCTCTGAACATGG - Intergenic
1033231906 7:139604857-139604879 CTGTCCCACAACTATGTACAGGG + Intronic
1037586201 8:20277987-20278009 CTGTAACACAACTATGTGCCAGG - Intronic
1037771487 8:21802876-21802898 ATCTAGAACAACTATGTATATGG - Intronic
1038414968 8:27388471-27388493 CTTCAAGACAACAATGTACAAGG - Intronic
1039480086 8:37866487-37866509 CATTATCACAACTATGTAAAAGG - Intronic
1041136742 8:54767105-54767127 CTGTAACACAACTGTGTACAAGG + Intergenic
1041693950 8:60715855-60715877 TTCTAATACCACTATGTATATGG + Intronic
1043809833 8:84724436-84724458 CTCTAACATAACTAAGTAGATGG - Intronic
1044115956 8:88334123-88334145 GTCTACCACAATTATTTACATGG - Intergenic
1044546013 8:93460272-93460294 CACAAACACTACTATGTAAAAGG + Intergenic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1047544949 8:125806733-125806755 CTCTAACACAGGTATTTCCAAGG - Intergenic
1049716793 8:144096712-144096734 CTCTAAGACATCTGTGTAGATGG - Exonic
1055102138 9:72477095-72477117 CTCAAACTCAAATATCTACAGGG - Intergenic
1185774527 X:2791979-2792001 CTCTAAAACAGCTTTGAACAGGG - Intronic
1187867314 X:23735574-23735596 CTCGAACATAACTATGGACTAGG + Intronic
1191905427 X:66083168-66083190 CTCTAACACTCCTATTTAGATGG - Intergenic
1193705440 X:84815494-84815516 CTTTAACACAAATTTGTAAAGGG - Intergenic
1195514858 X:105762518-105762540 CCCTATCAAAACTATGTTCAAGG + Intronic
1195974067 X:110506465-110506487 ATCTAACAAAAATATGTACAAGG + Intergenic
1198088254 X:133301871-133301893 TTCAAACCCAATTATGTACAGGG - Exonic
1199132811 X:144212972-144212994 CTCTAAGACAGCGATGTAGATGG + Intergenic