ID: 924165428

View in Genome Browser
Species Human (GRCh38)
Location 1:241276960-241276982
Sequence GTCTCTGGGCAGAGGTACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924165428 Original CRISPR GTCTCTGGGCAGAGGTACGA AGG (reversed) Intronic
901491228 1:9597365-9597387 GTCCCTGGGCAGAGGGAGGAAGG + Intronic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
902278722 1:15358973-15358995 GTCTCTGGAGAGAGTTACGATGG + Intronic
903539354 1:24088103-24088125 GTCTCTGGGCAGATGGAGGGTGG + Intronic
905929763 1:41778877-41778899 ATATCTGGGCAGAGATAGGAAGG + Intronic
911015594 1:93328846-93328868 GTCACTGGCCAGAGGGAGGATGG - Intergenic
911450509 1:98054553-98054575 TTCTCTGGGCTGAGGTCTGAAGG + Intergenic
912002826 1:104856358-104856380 GTCTGTGGGCACAGGCCCGAGGG + Intergenic
920250065 1:204617557-204617579 GCCTCTGGGCAGAGAGAAGATGG + Exonic
920349938 1:205331294-205331316 AGCACTGGGCAGAGGTAAGAAGG + Intergenic
921991613 1:221372965-221372987 GTCTGTGGGCACAGGCCCGAGGG + Intergenic
924165428 1:241276960-241276982 GTCTCTGGGCAGAGGTACGAAGG - Intronic
1064680490 10:17806714-17806736 GTCCGTGGGCACAGGTCCGAGGG + Intergenic
1067682282 10:48448686-48448708 GTCTCTGAGCACAGGAAGGAAGG - Intronic
1071519459 10:86320021-86320043 GCCTCTGGGCCCAGGCACGAGGG - Intronic
1072469170 10:95695975-95695997 GTCTCTGATCAGATGTACAATGG - Intergenic
1072896046 10:99367830-99367852 GTGTCTGGGCAGGGGAACTATGG - Intronic
1074060173 10:109958190-109958212 GTTTCTGAGCAGAGGTATGTAGG + Intergenic
1074162379 10:110845483-110845505 GTACTTGGGCAGAGGTACCATGG - Intergenic
1074544044 10:114388613-114388635 GTCTCAGTGCAGAGGTAGGCTGG - Intronic
1077319912 11:1936505-1936527 GCCCCTGGGCACAGGCACGAGGG + Intronic
1079136283 11:17777486-17777508 GTCTCCGGGCTGAGGGAGGAGGG - Intronic
1079766911 11:24405910-24405932 GTCTCTGGGCACAGGCCCGAGGG - Intergenic
1081232840 11:40607293-40607315 GTCTGTGGGCAGAGGCCGGAAGG - Intronic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1084560409 11:69902315-69902337 GCCTCTGCGCAGAGGTGGGAAGG - Intergenic
1084971633 11:72775291-72775313 TTGTCTGGGCAGAGGTGCCAAGG - Intronic
1085657500 11:78330359-78330381 GTCTCTGGGGACAGGAAAGAAGG + Intronic
1086001748 11:81992409-81992431 GTCTGTGGGCACAGGTCCGGGGG - Intergenic
1088626079 11:111731648-111731670 GTCTCTGGGTAGCGGTGGGAAGG + Intronic
1089399677 11:118157216-118157238 GGCTCTGGGCAGAGGCAGGTAGG + Intergenic
1100691967 12:97047850-97047872 GTCTCAGGCCAGAGGAAGGAAGG - Intergenic
1103927970 12:124434154-124434176 CTCTCTGGGAAGAGGTATGGGGG + Intronic
1104183025 12:126400512-126400534 GGCTCTGGGCAGAGGTGATAGGG - Intergenic
1107419718 13:40234907-40234929 GTCTCTGGGCAGAAGGAAAAAGG + Intergenic
1107803424 13:44131848-44131870 GTCTCTGGTGAGAGACACGAGGG + Intergenic
1108149085 13:47512712-47512734 GTCTCTGGGCTGAGGTTCCTGGG + Intergenic
1111405140 13:87793716-87793738 GTCTATGGGCACAGGCCCGAGGG + Intergenic
1113595817 13:111531003-111531025 GTCCCTGGGCAGAGGGAAGCAGG - Intergenic
1114193526 14:20458414-20458436 TTCCCTGGGGAGAGGTAGGAAGG - Exonic
1119389518 14:74281528-74281550 GCCTCTGGGCAGAGGAAGGAGGG - Intergenic
1119425797 14:74533998-74534020 GGCACTGGGCACAGGAACGAGGG + Intronic
1120211959 14:81641991-81642013 GTCTGTGGGCACAGGCCCGAGGG + Intergenic
1122662924 14:103309885-103309907 GACTCTGGGCAGAGCTGTGAAGG - Intergenic
1125932135 15:43607946-43607968 GTATCTGGGCAGAGCTACAGCGG - Exonic
1125945234 15:43707420-43707442 GTATCTGGGCAGAGCTACAGCGG - Intergenic
1126699847 15:51357927-51357949 GTCCCTAGGGACAGGTACGAGGG - Intronic
1128311045 15:66631978-66632000 GTCTCTGTGCAGAGGAAGGAAGG + Intronic
1128674972 15:69601971-69601993 TTCTCAGGGCAGAGCTAGGACGG + Intergenic
1130896938 15:88178168-88178190 GTCTCAGTGCAGAGGTAAGGGGG + Intronic
1131034914 15:89215790-89215812 GTCTCTTGGCAGAGGTGCCCAGG - Intronic
1132462740 16:63411-63433 GTCTCTGGGAAGGGGTACCTTGG - Intronic
1133022364 16:2972413-2972435 GTCTCTGGGCAGAGGGAGCCAGG - Exonic
1137491249 16:48934728-48934750 GTCTCTGGGCTGTGGTACTGTGG - Intergenic
1140693483 16:77508183-77508205 TTCTCTGAGCAGAGGTTTGATGG - Intergenic
1141463463 16:84191743-84191765 GTCTCTGAGCATAGGGACCAAGG - Intronic
1141648247 16:85378726-85378748 GTCTCTGGGCAGTGCCAGGAAGG + Intergenic
1143582951 17:7836927-7836949 GACTCGGGGCAGAGGTGGGAGGG - Intergenic
1145768411 17:27475259-27475281 GTCTCTGAGCACAGGTGTGAAGG + Intronic
1147201082 17:38801762-38801784 GTCTGTTGGCACAGGTAAGAAGG + Exonic
1149513195 17:57259046-57259068 GTCTCCAGGCAGAGGTCAGAAGG + Intronic
1149664155 17:58354167-58354189 TTATCTGGGCAGAGGAAGGATGG - Exonic
1150449031 17:65250409-65250431 GTCTCTGGGCTGAGGACAGATGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1150618419 17:66790002-66790024 GTCCCCGGGCAGAGGCACAATGG - Intronic
1150998973 17:70351830-70351852 GTCTGTGGGCAGAGGACCGAAGG - Intergenic
1151560085 17:74865341-74865363 GTCTATGGGAGGAGGCACGATGG + Intronic
1153874878 18:9360821-9360843 GTCTCTGGGCATAGGATCAAAGG - Intronic
1155380470 18:25217022-25217044 GGATCTGGGCAGAGTTAAGAAGG + Intronic
1156864130 18:41869542-41869564 GACTCTGGGGAGGGGGACGATGG + Intergenic
1157979588 18:52365530-52365552 GTTTATGGTCTGAGGTACGAGGG + Intronic
1159139737 18:64378930-64378952 GACTCTGGGCTGAGGGACCAAGG + Intergenic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1161138192 19:2633086-2633108 GTGTCTGCGCAGAGATCCGAGGG + Intronic
1162375014 19:10299781-10299803 GTCTCAGGGCAGGGGCACAACGG - Intergenic
1163783197 19:19261241-19261263 GTCTCTGGGGAGGGGAACGTGGG + Intronic
1166270163 19:41708616-41708638 GACTCAGGGCAGAGGGAGGAAGG + Exonic
1166626928 19:44366390-44366412 GTCTGTGGGAAGAGGTAGGAAGG - Intronic
1167049708 19:47070927-47070949 GTCCCTGGGCAGAGGCAGCAGGG - Intronic
1167339662 19:48907716-48907738 GGCTCTGGGCAGAGGAGGGACGG - Intronic
1168181674 19:54666226-54666248 GTCTCTGGGCTGGGGGAAGATGG - Exonic
1168241571 19:55091613-55091635 GGCTGTGGGCAGAGGGCCGAGGG - Intronic
927156971 2:20226051-20226073 GTCTCAGGGCCCAGGTGCGAAGG - Intergenic
927220301 2:20701511-20701533 GTAGATGGGCAGAGATACGAGGG - Intronic
927513437 2:23658513-23658535 GCCTCTGGGCAGAGGAGCCACGG - Intronic
937098815 2:119253045-119253067 TTCTCTGGGCAGAGGTACGGAGG + Intronic
937631425 2:124106412-124106434 ACCTCTGGGCAGAGGAAAGAGGG + Intronic
946420620 2:219562562-219562584 GGCCCTGGGCAGAGGTGCGCTGG - Exonic
948481783 2:238254888-238254910 GTCTCTGGGCAGACGCACCAAGG - Intronic
949034203 2:241809107-241809129 GTCTCTGGGAGGAGGAGCGAGGG + Intronic
1171226868 20:23449270-23449292 GCCTCAGGCCAGAGGTACTAGGG + Intergenic
1173668757 20:44782672-44782694 GTCTCATGGCAGAGGAATGATGG + Intronic
1177628967 21:23701890-23701912 GTGTCTGTGCAAAGGTAGGATGG - Intergenic
1178497807 21:33101819-33101841 GCCTCTGGGCAGAGTTATGGAGG - Intergenic
1179165738 21:38933828-38933850 GACTCTGGGCACAGGAAGGATGG - Intergenic
1179408376 21:41143597-41143619 GTGTCTGGGCACAGGTGAGAGGG - Intergenic
1179801275 21:43812519-43812541 GGCCCTGGGCAGCGGTACCAGGG - Intergenic
1181327406 22:22060705-22060727 GCCTCTGGTCACAGGCACGATGG + Intergenic
1181888264 22:26038807-26038829 GTCTCAGGGCAGAGAGACTAAGG - Intergenic
1181940261 22:26470339-26470361 GTCTCTGGGCAGCAGGAGGAGGG + Intronic
1185070127 22:48651529-48651551 GGTTCTGGGCAGAGGTATGGTGG + Intronic
1185121642 22:48974979-48975001 GTCTCTGGGCAGCCGCAAGAGGG - Intergenic
949617568 3:5770611-5770633 GTCTTTGGGCATAGGCCCGAGGG + Intergenic
952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG + Intergenic
954115284 3:48463770-48463792 GTCTCTGGGCTGAGGCACTTTGG - Exonic
955791033 3:62588981-62589003 TTCTCTGGGAAGGGATACGAGGG + Intronic
956019307 3:64916441-64916463 GTCACAGGGCAGAGGTCTGACGG - Intergenic
957025168 3:75173553-75173575 GTCCCAGGTAAGAGGTACGAGGG + Intergenic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
966830779 3:184006595-184006617 GTCTCTGGGTAGAGGAATTAAGG + Intronic
968610437 4:1554489-1554511 GTTTCTGGGCAGTGGTAGGTGGG - Intergenic
969479118 4:7437789-7437811 GTGTCTGGGCAAAGGTACTCGGG - Intronic
972676381 4:41263789-41263811 GTCTCTGGGGATAGGGAAGATGG - Intronic
977728751 4:100326892-100326914 ATCACTGGGCAGAGTAACGATGG + Intergenic
978459239 4:108931818-108931840 GGCTCTGGGCAAAAGTACCAAGG + Intronic
979449750 4:120856634-120856656 GTCTCTGGGAAGAGGAATGATGG - Intronic
980438245 4:132809245-132809267 GTCTGTGGGCACAGGCCCGAGGG - Intergenic
984587840 4:181583060-181583082 GTCCCTGGGCAGTGGGACTAGGG + Intergenic
990631912 5:57679702-57679724 GTCTCTGAGCAGAGGACCCAGGG + Intergenic
992904566 5:81333828-81333850 GTCTGTGGGCACAGGCCCGAGGG - Intronic
993188041 5:84645624-84645646 GTCTGTGGGCACAGGCCCGAGGG - Intergenic
994269534 5:97760572-97760594 GCCTCAGGACAGAGGTACTATGG + Intergenic
996214994 5:120855880-120855902 GTCTGTGGGCACAGGTCTGAGGG - Intergenic
997429795 5:133829869-133829891 TTCTCAGGGCAGAGGGACTATGG - Intergenic
997758193 5:136420194-136420216 GTCTATGGGTAGAGGGATGAGGG + Intergenic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
999501190 5:152148274-152148296 GTCTCTGGACAGTGGGAGGAAGG + Intergenic
1001875386 5:175195691-175195713 GTCTCTGGGGAGAAGAACCAAGG - Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1004250875 6:14022206-14022228 GTCTCTGGGTAGAGGTTCCCGGG + Intergenic
1006814231 6:36839751-36839773 GTCTGTGGGCAGAGGTAGAGGGG + Exonic
1006941614 6:37755426-37755448 GTCTCTGGGCAGAGGCAAGGAGG + Intergenic
1008680783 6:53869685-53869707 GTCTCTGGGAAGAGAGACCATGG - Intronic
1009346961 6:62625128-62625150 GTCTTATGGCAGAGGTAAGAAGG - Intergenic
1011784007 6:90824054-90824076 GGCTGTGGGGAGAGGTAAGAAGG - Intergenic
1012724901 6:102798739-102798761 GTCCCTGGGCACAGGCCCGAGGG - Intergenic
1014325334 6:119986503-119986525 GTCTGTGGGCACAGGCCCGAGGG - Intergenic
1016020939 6:139235694-139235716 GTCCCTGGGCACAGGCTCGAGGG - Intergenic
1016471574 6:144380365-144380387 ATCTCTGGGCAGAGGGAAAATGG + Intronic
1016647196 6:146424050-146424072 GTCACTGGGCAGAGGTCATAGGG + Intronic
1018647358 6:165960946-165960968 GTCTTTGGGCAGAAGCAAGAGGG + Intronic
1019163287 6:170083067-170083089 CTCTCTGGGCAGTGGTGCGGAGG - Intergenic
1019639084 7:2093469-2093491 TTCCCTGGGAAGAGGGACGACGG + Intronic
1023355860 7:39366585-39366607 GTCTCTGGGCCTGGGTAGGAGGG - Intronic
1029111257 7:98214053-98214075 ATCTCTGGGCAGAGGCATGAGGG - Intergenic
1030508638 7:110455875-110455897 GTCTCAGGGCAGAGGAAGAAGGG + Intergenic
1030746506 7:113172684-113172706 GTCTGTGGGCAAAGGCCCGAGGG - Intergenic
1031026614 7:116686312-116686334 ATTTCTGGGCAGAGGCAAGAAGG - Intronic
1033564708 7:142567304-142567326 GTCTGTGGGCACAGGCCCGAGGG - Intergenic
1035535273 8:386240-386262 GACCCTGGGCAGAGGTTCAAGGG - Intergenic
1037639360 8:20728801-20728823 GCCTCTGGGTAGAGGAAGGATGG - Intergenic
1037788454 8:21916990-21917012 TACTCTGTGCAGAGGTACTAGGG + Intergenic
1037839016 8:22231120-22231142 GTCTGTGGGCAGAGCCACGTAGG - Intronic
1038295169 8:26285613-26285635 GTCTCTGGACAGTGACACGATGG - Intergenic
1039032844 8:33328538-33328560 GTCTCTGGGCACAGATCCCATGG + Intergenic
1043311046 8:78859626-78859648 GTCTGTGGGCACAGGTCCGAGGG + Intergenic
1045717645 8:105067207-105067229 GTCCATGGGCACAGGTCCGAGGG + Intronic
1046839378 8:118840498-118840520 GTCTCTGGGCAGGGGAAAAATGG - Intergenic
1048970970 8:139644835-139644857 GGCTCTTGGCAGAGGTGCGCTGG - Intronic
1049201255 8:141341648-141341670 GTCTCGGGGCAGGGGCAGGAGGG + Intergenic
1049386920 8:142347480-142347502 GTCTCTGTGCAGAGAGAGGATGG - Intronic
1049404266 8:142444668-142444690 GCCTCTGGGCAGAGGAACTAGGG + Intergenic
1049407610 8:142458628-142458650 GTCTCTGGGCAGAGGTGACAGGG - Intronic
1049599212 8:143499252-143499274 TTCTCTGGACAGAGGGATGAGGG + Intronic
1049724685 8:144140248-144140270 GGCTCTTGGCAGAGGTAAGAAGG - Exonic
1050043557 9:1520762-1520784 GTCTGTGGGCACAGGCCCGAGGG - Intergenic
1056180322 9:84076487-84076509 GGCACTGGGCAGAGCTATGAGGG + Intergenic
1057292464 9:93815359-93815381 ATCTCTGGGCACAGATAAGAAGG - Intergenic
1057440066 9:95076730-95076752 GTCTCTGGGCATAGGGATGAGGG + Intronic
1058604749 9:106708281-106708303 GTCTCTGGTCAGATGTCCCAGGG - Intergenic
1060747743 9:126148903-126148925 ATCCCTGGGCAGAGGAACAAGGG - Intergenic
1186119165 X:6340071-6340093 TTCTCTGGGCAGAGGAATGCAGG + Intergenic
1187408386 X:19024845-19024867 GTCTCTGAGCACAGTTACGGAGG - Intronic
1187572096 X:20515139-20515161 GCCACTGGGCAGAGGTAGGATGG - Intergenic
1189053220 X:37668699-37668721 GTCACTTGGCAGAGGTGGGAGGG + Intronic
1189434238 X:40977259-40977281 GTCACTGGGTGGGGGTACGATGG - Intergenic
1195905011 X:109835982-109836004 GGCTCTGGGTAGAGGTACTAGGG - Intergenic
1196382604 X:115108471-115108493 GTCTGTGGTCCGAGCTACGAGGG + Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic