ID: 924165568

View in Genome Browser
Species Human (GRCh38)
Location 1:241278631-241278653
Sequence GTGGAAAAGGGATACTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924165568_924165577 12 Left 924165568 1:241278631-241278653 CCCACTGAGTATCCCTTTTCCAC 0: 1
1: 0
2: 1
3: 21
4: 165
Right 924165577 1:241278666-241278688 CTCACCACTGCTCCCAACAATGG 0: 1
1: 0
2: 0
3: 23
4: 211
924165568_924165580 16 Left 924165568 1:241278631-241278653 CCCACTGAGTATCCCTTTTCCAC 0: 1
1: 0
2: 1
3: 21
4: 165
Right 924165580 1:241278670-241278692 CCACTGCTCCCAACAATGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 185
924165568_924165578 13 Left 924165568 1:241278631-241278653 CCCACTGAGTATCCCTTTTCCAC 0: 1
1: 0
2: 1
3: 21
4: 165
Right 924165578 1:241278667-241278689 TCACCACTGCTCCCAACAATGGG 0: 1
1: 0
2: 1
3: 19
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924165568 Original CRISPR GTGGAAAAGGGATACTCAGT GGG (reversed) Intronic
903515242 1:23905996-23906018 GTGTAAAAGAGATTCTCAGTTGG + Intronic
907886322 1:58595225-58595247 GTGGAATATGGATATTTAGTTGG + Intergenic
908006678 1:59735230-59735252 ATGGAAAAGGGATTCTCAAGGGG - Intronic
909566162 1:77055707-77055729 GAGGAAGAGGGATGCCCAGTGGG - Intronic
913348265 1:117829469-117829491 GTGGAAAAGGGATAGTGGGGTGG - Intergenic
915269523 1:154743586-154743608 GTGCAAAAGCAATACACAGTCGG + Intronic
915999189 1:160598271-160598293 GTGGAAAAGATATACACAATAGG + Intergenic
917084997 1:171296425-171296447 GTGGAAAAGGGGAACTCCGCAGG - Intergenic
917303192 1:173600269-173600291 GTGCAAAAGTGATACACATTTGG - Intronic
917303201 1:173600360-173600382 GTGCAAAAGTGATACACATTTGG + Intronic
917978631 1:180255911-180255933 GTGGAAACGGGGTCCCCAGTGGG + Intronic
919590903 1:199500817-199500839 GTGGACAATGGAAACTCAGAGGG + Intergenic
920767697 1:208849394-208849416 ATGGAAAAGGAATACTTATTTGG + Intergenic
921251237 1:213300472-213300494 GGGAAAAAGGGAAACTCAGAGGG - Intergenic
921339608 1:214121704-214121726 ATGGACAATGGAGACTCAGTGGG + Intergenic
921937739 1:220810454-220810476 GTGGAAAAGGGGTTCTCGGTGGG - Intronic
923765007 1:236884953-236884975 CAGGAAAAGGTAAACTCAGTGGG - Intronic
924165568 1:241278631-241278653 GTGGAAAAGGGATACTCAGTGGG - Intronic
1069317295 10:67122066-67122088 GTGAAGAAGGGAGATTCAGTTGG + Intronic
1069857137 10:71447572-71447594 GTGGAAAACGGCTACTCCTTTGG + Intronic
1070530758 10:77335254-77335276 GTGGAACAGGGACTCTCAGTGGG - Intronic
1077670973 11:4157329-4157351 GTGAAGAAGGGAGTCTCAGTGGG + Intergenic
1078144926 11:8716086-8716108 GTGGAAAAAGAAGACTAAGTGGG + Intronic
1078568209 11:12435258-12435280 GAAGAAAAGGGAGAGTCAGTGGG - Intronic
1079968348 11:27006039-27006061 GTGGAAAAGGGATAAATAATTGG - Intergenic
1080196511 11:29616156-29616178 GGGGAAAAGGGATAGTGACTTGG - Intergenic
1082031544 11:47608099-47608121 GTGGAAAAGTGAGACTCAGAAGG - Intergenic
1083376053 11:62222284-62222306 GTGAAAAAGGGATAGCCAATTGG - Intergenic
1084326411 11:68402889-68402911 ATGGGAAAGGGATCCTCAGCTGG + Intronic
1086334825 11:85789930-85789952 TTGGATAAGGGATACTCAACCGG - Intronic
1087976768 11:104559128-104559150 GTTGAAAATGGCTACTCAGGAGG + Intergenic
1089984200 11:122797779-122797801 GAGGAAATGGCATTCTCAGTGGG + Intronic
1090341395 11:126024314-126024336 GTGGAAAAGGGAGACTAAGCAGG + Intronic
1095445400 12:42277425-42277447 CTGGAAATGGGATAGTAAGTCGG - Intronic
1095486870 12:42694502-42694524 GTGGAAATGGGACACTAACTAGG - Intergenic
1098310066 12:69139763-69139785 GGGGAAAAGGAATTCTCAATAGG - Intergenic
1103154092 12:118668317-118668339 GTGCAGAAGGTATACTCAGGAGG + Intergenic
1103155093 12:118677857-118677879 GTGCAGAAGGTGTACTCAGTAGG - Intergenic
1103638392 12:122328241-122328263 CTGGTAAGGAGATACTCAGTGGG - Exonic
1106622991 13:31389253-31389275 GCTGAAAAGGGGTATTCAGTGGG + Intergenic
1107944256 13:45403450-45403472 GTAGGAAAGGAATACTCTGTGGG + Intronic
1110638302 13:77791441-77791463 GTGGAGATGGGAAACTTAGTTGG - Intergenic
1111067940 13:83122251-83122273 GAGGAACAGGCATATTCAGTGGG - Intergenic
1111122447 13:83871505-83871527 GCGGAAAAGGGATTCTCCATAGG - Intergenic
1111483322 13:88861367-88861389 TTGAAAAAGGTATACTAAGTAGG + Intergenic
1113057135 13:106280955-106280977 GTGGTAAAGTGAAATTCAGTAGG - Intergenic
1114071434 14:19111743-19111765 TTGGACAAGGGATACTCAACAGG - Intergenic
1114090828 14:19288225-19288247 TTGGACAAGGGATACTCAACAGG + Intergenic
1114627870 14:24141152-24141174 GTGGAAGAGGGGCACACAGTCGG + Exonic
1116822465 14:49638807-49638829 GTGGAAAAGAGATTGTCAGAAGG - Intergenic
1117575569 14:57093854-57093876 GTAGAAAAGGGACACACAGTGGG + Intergenic
1120089243 14:80312031-80312053 TTGGATAAGGGATACTCAACCGG - Intronic
1120625479 14:86820358-86820380 TTGGAAAAGTATTACTCAGTGGG + Intergenic
1122958682 14:105084530-105084552 GTGGAAAAGGGTCACTCAGCAGG - Intergenic
1123893589 15:24805859-24805881 GTGGAAAAGGGAATCCCTGTGGG - Intergenic
1125805964 15:42494020-42494042 GAAGAGAAGGGATAGTCAGTAGG - Intronic
1127280558 15:57487410-57487432 GGGCAAAAGTGATACTTAGTGGG + Intronic
1128694780 15:69752868-69752890 GTTGAAAAGGGCTTTTCAGTTGG - Intergenic
1133285575 16:4689072-4689094 GTAGAAAAGGGAGACTCAGAAGG - Exonic
1133521551 16:6563127-6563149 GTGCAAAATGAATACTCAGGTGG + Intronic
1137067115 16:35858422-35858444 ATGGACAATGGATACTCAGTGGG + Intergenic
1138522057 16:57576676-57576698 GAGGAAATGGGTCACTCAGTAGG - Exonic
1145116463 17:20214832-20214854 GTGTAGAAGGGAGGCTCAGTAGG + Intronic
1146365716 17:32225819-32225841 GTATAAAAGGAATACTCAGCCGG + Intronic
1148554038 17:48567170-48567192 GTTAACAAGGGATTCTCAGTGGG - Intronic
1148823593 17:50376034-50376056 ATGGAAAAGGGACTGTCAGTGGG - Intronic
1149505334 17:57189458-57189480 GTGGCAAAGGGAAACTCTGTAGG - Intergenic
1150850900 17:68702822-68702844 GAGGAGAATGGATACTGAGTAGG - Intergenic
1151541906 17:74768896-74768918 GTGGCAAAGGGACACCCGGTAGG - Exonic
1155936744 18:31762579-31762601 GTGGAGAAGGGGTCCTCATTTGG - Intergenic
1157640709 18:49210862-49210884 GGAGAAAAGGCATACTCACTGGG + Intronic
1158502419 18:58015089-58015111 GTGGAGAAGGGATGCTAAATTGG - Intergenic
1164965726 19:32481002-32481024 GTGGACACAGGACACTCAGTAGG - Intronic
1166157361 19:40924065-40924087 GTGGATAAGGGATAGGCATTAGG + Intergenic
1167598092 19:50437810-50437832 GTGGTAGAGGGATAAGCAGTGGG - Intronic
1167734137 19:51281472-51281494 CTGGAAAAGGGAGACAGAGTAGG + Intergenic
1168679821 19:58306424-58306446 GTGGAAAATTGAGACTGAGTAGG + Intronic
925140249 2:1545109-1545131 ATGGAAAGAGGATATTCAGTAGG - Intergenic
927652959 2:24923235-24923257 GTGGATATGGGAAACGCAGTGGG + Intergenic
928500911 2:31894366-31894388 GTGGAAAACCCACACTCAGTAGG + Intronic
928831585 2:35492361-35492383 ATACAAAAGGGATTCTCAGTAGG + Intergenic
929145322 2:38702437-38702459 GTGGGAAAGGGATGCACAGCAGG - Intronic
929159758 2:38819555-38819577 GTGGAAAAAGTGTAATCAGTGGG + Intronic
936493654 2:112998342-112998364 GTGTAAAAGAAATACTGAGTAGG + Intergenic
937296756 2:120814118-120814140 GTGCAAAAGGAACCCTCAGTGGG - Intronic
939001611 2:136742223-136742245 GTGCAAAAGTGAGACACAGTTGG + Intergenic
941756343 2:169190590-169190612 GTGGGAAAGATATACTAAGTAGG - Intronic
943261181 2:185665626-185665648 GTGGAGCAGGGATACCCCGTAGG - Intergenic
943583182 2:189708432-189708454 GTGCAAAAGTGATACACATTCGG + Intronic
943662175 2:190570800-190570822 AGGGAAAAGGGATATTCAGTAGG + Intergenic
946806657 2:223477260-223477282 GTGGAACAGGGATACTCCATAGG + Intergenic
947952375 2:234159446-234159468 GTGAAAATGGGATAAACAGTTGG + Intergenic
1172880314 20:38195523-38195545 GTGTGAAAGGGGTCCTCAGTGGG + Intergenic
1173963754 20:47095177-47095199 CTGGGAAAGGAATACTCAGAGGG + Intronic
1174471392 20:50763725-50763747 GTGGCACACGGCTACTCAGTAGG - Intergenic
1174682302 20:52420435-52420457 GGAGAAATGGGATACTCAATTGG - Intergenic
1176659535 21:9621497-9621519 GTGGAAAAGGGATTATAAGTGGG + Intergenic
1177557858 21:22715192-22715214 GTGGAGCAGGGATACTCCTTAGG - Intergenic
1178722882 21:35025823-35025845 GAGGAAAAGGGAAACTCATATGG + Intronic
1179538460 21:42067886-42067908 GTGGAAAAGGAAAAGTCATTCGG + Intronic
1180489879 22:15834075-15834097 TTGGACAAGGGATACTCAACAGG - Intergenic
949334813 3:2962781-2962803 CGGGAAAATGGATACTGAGTAGG + Intronic
950760707 3:15222247-15222269 GTGGAACAGGGCTACTCCATAGG - Intronic
951126147 3:18985806-18985828 GAGGAAAAGGGATAGAAAGTAGG + Intergenic
951825617 3:26865099-26865121 GGGGAAATAGGATTCTCAGTTGG + Intergenic
955326132 3:58010304-58010326 GTGGAAAAGGGATTCCCTCTAGG + Intronic
955906665 3:63814790-63814812 GTAGAGAAGAGATACTCAGTTGG - Intergenic
957979299 3:87488162-87488184 GTGGAAATGGTATACTGAGCTGG - Intergenic
959234622 3:103703939-103703961 GTGGCAAAAGGAGTCTCAGTTGG - Intergenic
962704495 3:138029904-138029926 GCGGAACAGGGAGACTCACTTGG - Exonic
963242390 3:143020286-143020308 GTGGAAACAGTATACTCACTGGG + Intronic
966402070 3:179557736-179557758 GTAGAAACAGCATACTCAGTAGG + Intergenic
970674720 4:18435846-18435868 GTGGAAGAGGGAGATGCAGTGGG + Intergenic
971516551 4:27494040-27494062 GTGGAATAAGGAAAGTCAGTGGG - Intergenic
971795341 4:31219749-31219771 GTGGAAAAAGGAGGCTGAGTAGG - Intergenic
975296610 4:72742395-72742417 GTGGAAAAGAGAAACTTGGTTGG + Intergenic
975659237 4:76671878-76671900 TTGGATAAGGGATGCTCAGCTGG - Intronic
977984334 4:103363945-103363967 GAGGAGAAGGGATATTGAGTAGG + Intergenic
982538622 4:156639340-156639362 GGGGAAATGGGATACTGAGATGG + Intronic
984374044 4:178904124-178904146 GTGGAAAAAGAATAGTAAGTTGG + Intergenic
984766568 4:183404678-183404700 GTGGAAAATGGATTCACAATGGG + Intergenic
985415837 4:189734916-189734938 GTGGAAAAGGGATTATAAGTGGG - Intergenic
986351706 5:6886189-6886211 GTAGAAAATGGAGACTCAGGGGG - Intergenic
986895197 5:12357368-12357390 GGAGAAATGGGATACTCATTGGG - Intergenic
987064925 5:14280663-14280685 GTGGATCTGGGATACTCAGCTGG + Intronic
987644278 5:20648638-20648660 GTGGCAGAGGGATAGTCAGTTGG - Intergenic
993158951 5:84263810-84263832 GTGGAGAAGGAATAATCAGAAGG + Intronic
994489848 5:100427240-100427262 ATGGTAAATGGATACTCAGCAGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995350082 5:111164944-111164966 GTGGAAAAGGGATATGAAGCAGG - Intergenic
995554035 5:113309353-113309375 GTGGACATGGGAGACTCAGTGGG - Intronic
996206529 5:120744826-120744848 GAGGAAAAGGGATTGTCAATGGG + Intergenic
997118069 5:131147373-131147395 GCTGAAAAGGGAGGCTCAGTAGG + Intergenic
1000190391 5:158904682-158904704 GGGGTAAAGGTAGACTCAGTGGG - Intronic
1000820783 5:165980821-165980843 TTGGAAAATGAATACTAAGTTGG + Intergenic
1001172718 5:169436066-169436088 GTAGAAGAGAGAGACTCAGTAGG - Intergenic
1001528864 5:172448369-172448391 GTGACAAAGGGAGACTCTGTCGG - Intronic
1002286582 5:178166369-178166391 GTGGAGAAGGGAAACTCTGGAGG + Intergenic
1004476591 6:15979194-15979216 AGGGAAAGGGGATACCCAGTGGG - Intergenic
1005559333 6:27021624-27021646 CTGGTAAAGGTATAGTCAGTGGG + Intergenic
1007144697 6:39616672-39616694 GTGCAAAAAGGATTTTCAGTGGG - Intronic
1007186321 6:39975324-39975346 GTGGCAAAGTGATTCTGAGTAGG - Intergenic
1008580346 6:52901260-52901282 GGGGAAAATGAATACTCAATGGG - Intronic
1008631881 6:53369888-53369910 GTGGGAAGGGGAAACACAGTAGG + Intergenic
1008874291 6:56308811-56308833 GTGGCTAGTGGATACTCAGTTGG + Intronic
1010840085 6:80638795-80638817 GGGGCTAATGGATACTCAGTAGG - Intergenic
1012004462 6:93695021-93695043 GTGGAAAAGGAAGAATCAGAGGG + Intergenic
1013377107 6:109528108-109528130 CTGGAGAAGGGATACTGCGTAGG + Intronic
1014736240 6:125098891-125098913 CTGGAGAAGGGAGACCCAGTTGG - Intergenic
1017149600 6:151266893-151266915 GTTGAAAGGAGATACTCAGGAGG + Intronic
1017549766 6:155493452-155493474 GAGAAAAAGGGAGACTCAGAGGG + Intergenic
1020489416 7:8760835-8760857 GTGGAAAATGGATTGTAAGTGGG + Intergenic
1020693212 7:11384613-11384635 GTGGCAGAGGGAAAGTCAGTGGG - Intronic
1020745535 7:12074108-12074130 GGGCAAAAGGGATAGTCAATTGG - Intergenic
1021201487 7:17732617-17732639 TTGGAAAAGGGAGACTTAATTGG + Intergenic
1023617572 7:42035606-42035628 GTGAGAAAGTGATACCCAGTGGG + Intronic
1023992600 7:45138039-45138061 GTGGAAAAAGGGTACCCAGGGGG - Intergenic
1026422844 7:70258309-70258331 ATGGAGAAGGAATACTAAGTAGG + Intronic
1027642393 7:80753123-80753145 TTGGAAAAGGAATACTTAGGTGG - Intronic
1029923375 7:104290025-104290047 ATGGAAAAGGGACACTCAGTAGG - Intergenic
1031883403 7:127221344-127221366 GTGGAAAAGGAATACTGGGCAGG - Intronic
1032237067 7:130134228-130134250 AAGGAAAAGGAATAATCAGTAGG + Exonic
1033166786 7:139046088-139046110 GTTGAAAAGGGAAAATCAGAAGG + Exonic
1036025952 8:4909395-4909417 GTGGAAAATTCATACTTAGTGGG - Intronic
1038461720 8:27722854-27722876 GGAGAAAAGGGATACCCTGTTGG - Intergenic
1038626297 8:29196708-29196730 TTGGATGAGGGATACTCAGCTGG - Intronic
1040410493 8:47149553-47149575 TTGAAAAAGGGAAACTCAGCCGG + Intergenic
1045312435 8:101014722-101014744 GTGGGAAAGTGAGACGCAGTGGG + Intergenic
1046053502 8:109052115-109052137 GTGGAACAGGAACACTGAGTTGG - Intergenic
1047904700 8:129460394-129460416 GTGGAAAGGGGATAAGCTGTGGG - Intergenic
1047915689 8:129581837-129581859 GTGGAACATGGAAACTCAGTGGG + Intergenic
1050506471 9:6354038-6354060 GTGGCAAAGGGATGGACAGTAGG - Intergenic
1050758117 9:9033207-9033229 TTGGAAAAGGGATGCACTGTGGG - Intronic
1052489553 9:29148354-29148376 GTGGAAAGGTGATACTGAATAGG - Intergenic
1053175031 9:35916346-35916368 TTTGAAAAGGCAGACTCAGTTGG + Intergenic
1055411725 9:76037656-76037678 GTGGAAGAAAGATACTCTGTAGG + Intronic
1058103800 9:100947031-100947053 GTGCAAAAGGGATAGTCATTTGG - Intergenic
1058831034 9:108816504-108816526 GTAGAAAAGGGAAGCTCAGTGGG - Intergenic
1059686554 9:116642895-116642917 CTGGAAAAGGGATAGGCAGAAGG - Intronic
1061247679 9:129409272-129409294 GTGCAAAAGGGACACTAACTTGG + Intergenic
1203637096 Un_KI270750v1:123340-123362 GTGGAAAAGGGATTATAAGTGGG + Intergenic
1186472683 X:9833814-9833836 GTGGGACAGGGAGACACAGTGGG - Intronic
1187814176 X:23213291-23213313 GGGGAAAAGGGACACTATGTTGG - Intergenic
1190225525 X:48541781-48541803 GTGCAAAAGCGATACGCATTTGG + Intronic
1192024091 X:67429762-67429784 ATGGACAAGGGATCCTCAATAGG - Intergenic
1193292918 X:79797731-79797753 GTGCAAATGGGATATTCAGGTGG + Intergenic
1195867782 X:109451894-109451916 GTGGAAAAAAGAAAATCAGTGGG + Intronic
1199406516 X:147468069-147468091 GTTAAAAAGTGATACACAGTTGG - Intergenic