ID: 924166247

View in Genome Browser
Species Human (GRCh38)
Location 1:241286429-241286451
Sequence CTGAACTAGGTTTAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924166247_924166261 22 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166261 1:241286474-241286496 CCCCAAAAAAATGGGGATGGGGG 0: 1
1: 0
2: 2
3: 31
4: 350
924166247_924166257 20 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166257 1:241286472-241286494 ACCCCCAAAAAAATGGGGATGGG 0: 1
1: 0
2: 4
3: 30
4: 236
924166247_924166253 15 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166253 1:241286467-241286489 TTCCCACCCCCAAAAAAATGGGG 0: 1
1: 0
2: 4
3: 24
4: 306
924166247_924166251 13 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166251 1:241286465-241286487 AATTCCCACCCCCAAAAAAATGG 0: 1
1: 0
2: 1
3: 36
4: 387
924166247_924166259 21 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166259 1:241286473-241286495 CCCCCAAAAAAATGGGGATGGGG 0: 1
1: 0
2: 2
3: 20
4: 276
924166247_924166256 19 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166256 1:241286471-241286493 CACCCCCAAAAAAATGGGGATGG 0: 1
1: 0
2: 3
3: 33
4: 249
924166247_924166252 14 Left 924166247 1:241286429-241286451 CCTTCCATCTAAACCTAGTTCAG 0: 1
1: 0
2: 0
3: 8
4: 160
Right 924166252 1:241286466-241286488 ATTCCCACCCCCAAAAAAATGGG 0: 1
1: 0
2: 1
3: 21
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924166247 Original CRISPR CTGAACTAGGTTTAGATGGA AGG (reversed) Intronic
901002004 1:6153526-6153548 CTGATTTGGGTTTTGATGGAAGG - Intronic
903402479 1:23065556-23065578 CTTAACTAGGTGGAAATGGATGG + Intronic
903674028 1:25053259-25053281 CTGAACTTGGTTTCTCTGGAAGG - Intergenic
905222068 1:36454984-36455006 CTTAACTTGGTGTAAATGGATGG + Intergenic
905560322 1:38921456-38921478 ATGAATGAGTTTTAGATGGATGG + Intronic
905617651 1:39412724-39412746 CTGAACCAGTTTTAGAGGAATGG + Exonic
907158776 1:52356665-52356687 TTGAGTTAGGTTTTGATGGAAGG - Intronic
907957462 1:59243664-59243686 CTGAACTAGTTTTAGTTCTAGGG + Intergenic
908290616 1:62663179-62663201 CTAAACTAGTTTAAAATGGAGGG + Intronic
912328730 1:108796450-108796472 CTGAACTTGGTTAAGATAAAAGG + Intronic
915140872 1:153767810-153767832 CTGACCTCTGTGTAGATGGAGGG - Exonic
915786688 1:158621000-158621022 CTGAACAAGGTTTAAAAGGAAGG - Intronic
915833756 1:159156410-159156432 ATAAACTAGGTATTGATGGAAGG - Intergenic
916968786 1:169985344-169985366 CTGAACTAGGTAGAGATAAAAGG + Intronic
917063583 1:171067279-171067301 CTGAATTGGGTTTTGAAGGATGG - Intergenic
917163730 1:172087623-172087645 ATGAACTTGGTAAAGATGGATGG - Intronic
917311020 1:173678536-173678558 ATAAACTAGGTGTTGATGGAAGG + Intergenic
920589150 1:207199882-207199904 ATAAACTAGGTATTGATGGAAGG + Intergenic
921192562 1:212723769-212723791 CTGAGCTGGGCTTAGCTGGATGG - Intergenic
921573662 1:216808294-216808316 CTGAACTTGGGTTACTTGGAAGG + Intronic
924166247 1:241286429-241286451 CTGAACTAGGTTTAGATGGAAGG - Intronic
924212097 1:241780416-241780438 CTGCACTAGGTTTGCAAGGAAGG - Intronic
924780390 1:247141863-247141885 CTGAACTAGGTCTTGATAAATGG - Intronic
924953916 1:248909482-248909504 CTGCAGCAGGTTGAGATGGACGG + Intronic
1066341774 10:34541481-34541503 TTGTACAAGGTTGAGATGGAAGG - Intronic
1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG + Intronic
1070343303 10:75517869-75517891 ATAAACTAGGTATTGATGGAAGG - Intronic
1073848781 10:107590157-107590179 CTGAACTACATTTACATGCATGG - Intergenic
1073945493 10:108745328-108745350 CTGAACCAGATTAAGATGGAGGG + Intergenic
1074445388 10:113517383-113517405 AAGAACTAGGTTTAGATCAAGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076423251 10:130348810-130348832 CTGAACTAGCTTTAGAGTGCAGG - Intergenic
1077800723 11:5533366-5533388 CTGAAGCAGGATTGGATGGATGG - Intronic
1078135326 11:8647329-8647351 CTGTGCTGGGTTTAGATGGTAGG - Intronic
1078915852 11:15778310-15778332 CTGAACTATCTCTAGATGGTAGG - Intergenic
1081201246 11:40218759-40218781 CTACCCTAGGTTTGGATGGATGG - Intronic
1081363648 11:42209340-42209362 ATAAACTAGGTATTGATGGAAGG + Intergenic
1081707453 11:45192067-45192089 CCGAACTAGGTTTTGAGGGAGGG + Intronic
1082182944 11:49142635-49142657 ATAAACTAGGTATTGATGGAAGG + Intergenic
1084620936 11:70270196-70270218 CTGATCTGGGTTCAGAAGGACGG - Intergenic
1085170092 11:74442393-74442415 CTTAACTATGTTCAGATGTAAGG + Intergenic
1088038058 11:105342250-105342272 ATAAACTAGGTATTGATGGATGG - Intergenic
1091618517 12:2067863-2067885 CTGGGCTTGGTTTGGATGGAAGG - Intronic
1094214962 12:27931019-27931041 CTGTCCTAGGTTTAGATCTAAGG - Intergenic
1095334056 12:41005925-41005947 CTGAACTGGGCTCAGATGGCTGG - Intronic
1095784014 12:46090518-46090540 CTGAGCTATGTCTAGAAGGAGGG + Intergenic
1098529226 12:71521596-71521618 CTTAATCAGGTTTAGATGCAAGG + Intronic
1098808272 12:75049945-75049967 GTGAATTAGGTTGAGATGCATGG + Intronic
1100129787 12:91477561-91477583 ATGAGCAAGGTTTAGCTGGAGGG - Intergenic
1102817641 12:115880560-115880582 CTGATCTGGATTCAGATGGAAGG + Intergenic
1106992628 13:35440268-35440290 ATAAACTAGGTCTAGAAGGATGG + Intronic
1109135001 13:58636984-58637006 GTGAACAAGGTTTAGATGACTGG - Intergenic
1112545377 13:100363505-100363527 CTGAACTTGGTTCAGATGAATGG + Intronic
1113696004 13:112346019-112346041 CGGCACTAAGCTTAGATGGAAGG + Intergenic
1115379125 14:32713735-32713757 CTGAATTAGGTTTGGCTTGAGGG + Intronic
1117568311 14:57019398-57019420 CTGTACTAGGATTAGAAAGAAGG - Intergenic
1120546281 14:85815479-85815501 CTACTCTAGGTTTAGGTGGAAGG + Intergenic
1126209161 15:46080206-46080228 CCAAATTAGATTTAGATGGACGG + Intergenic
1127215871 15:56822518-56822540 CTGAACTAAGTTTAACTGAAGGG - Intronic
1127723967 15:61729305-61729327 CTGAATTAGGCTTATATGGTGGG - Intergenic
1134821297 16:17249468-17249490 CTGACATTGGTTTAGATGGTGGG - Intronic
1137515118 16:49136834-49136856 CTGAACTCGGTATAAATGGCTGG + Intergenic
1140132191 16:72173067-72173089 CTGAACCAGGTTTAGAAGCTTGG - Intronic
1140475810 16:75238771-75238793 CAGAACTATTTTTAGATGCAGGG + Intronic
1149925451 17:60697745-60697767 CTGGACAAGGTTTTGAAGGATGG + Intronic
1153519020 18:5934561-5934583 CTGAAATACCTCTAGATGGATGG - Intergenic
1158344122 18:56497715-56497737 ATGAATTAAGTTTGGATGGATGG + Intergenic
1160202547 18:76807535-76807557 CCGAGCTAGGTGTAGCTGGAAGG + Intronic
1161329640 19:3680214-3680236 CTGATTTTGGTTTGGATGGATGG - Intronic
1164040676 19:21490077-21490099 GTGAGCTATGTTTATATGGAAGG - Intronic
1167101363 19:47406161-47406183 GTGGACTAGGTTTGGATGGATGG + Intronic
926130498 2:10301112-10301134 CTGACCTAAGTTTTGAAGGATGG + Intergenic
930457587 2:51625379-51625401 CAGAACTATGTTTATATCGATGG - Intergenic
932909647 2:75792259-75792281 CTTGACTAGGTTCAGCTGGATGG + Intergenic
933874542 2:86605866-86605888 TTGAACTAGGTCTTGAAGGATGG + Intronic
934619472 2:95795355-95795377 CTGAGCTAGGCTTGGAGGGAAGG - Intergenic
934641418 2:96029202-96029224 CTGAGCTAGGCTTGGAGGGAAGG + Intronic
935709523 2:105885120-105885142 CTGAACAAGCTTTACAAGGATGG - Intronic
937576684 2:123431419-123431441 CAGAACTAGGTTTAAATGTCAGG + Intergenic
939863006 2:147441683-147441705 CTGAACTAGGTTTTGAACCAAGG - Intergenic
942918439 2:181341791-181341813 TTGAACAAGCTTTAGATTGAAGG + Intergenic
943130311 2:183845800-183845822 ATAAACTAGGTATTGATGGAAGG + Intergenic
1169629409 20:7611122-7611144 CTATACTAGGTTTAGATCAAGGG + Intergenic
1170454900 20:16523006-16523028 ATAAACTAGGTATTGATGGAAGG + Intronic
1170868884 20:20186581-20186603 CTGAACTAGATTTTGGTGTAAGG + Intronic
1173722181 20:45269121-45269143 CTGACCTAGGGTTATAAGGATGG + Intergenic
1173750784 20:45474347-45474369 ATAAACTAGGTATTGATGGAAGG - Intronic
1178396811 21:32250139-32250161 TTGAACTAGGTTCAGATGTTGGG - Intergenic
1179298352 21:40083125-40083147 CTAAATGAGGTTTATATGGAAGG - Intronic
949419248 3:3848320-3848342 TGGAACTAGGTTTAGGTAGAAGG + Intronic
953885181 3:46711026-46711048 CTGAATTAGGATGAGATAGAGGG + Intergenic
953926896 3:46987229-46987251 CAGAACTATCTTTGGATGGATGG - Intronic
954715760 3:52525962-52525984 CTGAACTAAGTTCAAGTGGAGGG + Intronic
957423623 3:80005869-80005891 CTGAACTACATTTAGCTGTAAGG + Intergenic
962557307 3:136567063-136567085 GTTAACTATGTGTAGATGGATGG + Intronic
963300889 3:143596003-143596025 CTGGACCAGGATGAGATGGAGGG + Intronic
963934185 3:151035456-151035478 AGGAACTAGCCTTAGATGGAAGG - Intergenic
968243144 3:197111288-197111310 GTGAACTAGGTTGAGTTGGTTGG + Intronic
970171591 4:13295963-13295985 CTGAACGAGGTGGAGCTGGATGG - Intergenic
973742313 4:53929990-53930012 CTGAAATGGGATGAGATGGAAGG - Intronic
974958569 4:68672985-68673007 ATGAAGTTGGTTGAGATGGAGGG - Intergenic
976084413 4:81392893-81392915 CTGACACAGGTTTTGATGGATGG - Intergenic
977170127 4:93751704-93751726 CTGACCTGGGTTTAGTTTGAGGG - Intronic
978699072 4:111621138-111621160 CTAAACTAGCTTTAAATGCAAGG - Intergenic
980330045 4:131399780-131399802 ATAAACTAGGTATTGATGGAGGG - Intergenic
980554482 4:134384650-134384672 CTGAACTATTTATAGATGGGTGG + Intergenic
980696341 4:136361514-136361536 ATAAACTAGGTATTGATGGAAGG + Intergenic
981312848 4:143313723-143313745 CTGAGCTAGGCTTTGATGGGTGG - Intergenic
982268730 4:153565031-153565053 CTGAACTGGGTCTTGAAGGATGG - Intronic
989522110 5:42414481-42414503 ATAAACTAGGTATTGATGGAAGG - Intergenic
990659120 5:57993166-57993188 CTGAACAAGGTCTAGTTTGAGGG - Intergenic
990745486 5:58955242-58955264 ATAAACTAGGTATTGATGGAAGG - Intergenic
992340726 5:75820618-75820640 ATAAACTAGGTATTGATGGATGG + Intergenic
993217671 5:85047032-85047054 TTGGAATAGATTTAGATGGATGG + Intergenic
994113930 5:96040541-96040563 ATAAACTAGGTATCGATGGAAGG - Intergenic
994666242 5:102708915-102708937 CTGAACTAGGCCTTGATGGATGG + Intergenic
996771512 5:127091600-127091622 CTGAACTCGGTTGACATGCATGG - Intergenic
996818239 5:127597012-127597034 CTGGAGTTGGTTTTGATGGACGG + Intergenic
996948026 5:129094028-129094050 CAGAAATAGGTTGAGATGAAGGG + Intergenic
999931179 5:156434310-156434332 CTGAACAGAGTTTAGATGGGAGG + Intronic
1002686169 5:181011985-181012007 ATAAACTAGGTATCGATGGAAGG + Intergenic
1003158967 6:3619179-3619201 CTGAACTAGGTGGAGATGTTAGG + Intergenic
1003229012 6:4232947-4232969 ATAAACTAGGTATTGATGGAAGG + Intergenic
1006222775 6:32508100-32508122 ATAAACTAGGTATTGATGGAAGG + Intergenic
1009801170 6:68538132-68538154 ATAAACTAGGTATTGATGGAAGG + Intergenic
1010119451 6:72357233-72357255 CTCAACTAGGTTCAGTTGGAGGG + Intronic
1012427892 6:99134364-99134386 CTGAACTAGGTTCAGTTAAAGGG + Intergenic
1014326439 6:120001792-120001814 CAGAGCTAGGTTTTGAGGGATGG + Intergenic
1016844308 6:148556107-148556129 CTCAAGTAGGGTTAGATGAATGG - Intergenic
1017499264 6:155008478-155008500 CTGAACCAGGTTTTCCTGGAAGG + Intronic
1017645080 6:156532952-156532974 CTGAATGAGAGTTAGATGGATGG + Intergenic
1017968309 6:159286673-159286695 ATAAACTAGGTATTGATGGAAGG - Intergenic
1019851265 7:3560690-3560712 CTGAACTCTGTTTAAATGGGTGG - Intronic
1021460885 7:20885587-20885609 ATAAACTAGGTATTGATGGAAGG - Intergenic
1023390008 7:39700626-39700648 CTCACCTAGGTTGAGAAGGAAGG + Intronic
1024113871 7:46173867-46173889 AAGAACGAGGTTTAGATAGAAGG + Intergenic
1025869338 7:65416021-65416043 TTGAAAAAGGATTAGATGGATGG + Intergenic
1027729522 7:81852982-81853004 CTTACCTAAGTTTAGATGAAGGG - Intergenic
1031381464 7:121091217-121091239 CTGTATTAGGTTTCTATGGATGG - Intronic
1034294279 7:149958073-149958095 TTGAACTAGGTTCACATTGATGG + Intergenic
1034811792 7:154138799-154138821 TTGAACTAGGTTCACATTGATGG - Intronic
1037132561 8:15424400-15424422 CTGGACTATGTCTAGAGGGAGGG + Intronic
1037556450 8:20028630-20028652 ATAAACTAGGTATTGATGGAGGG - Intergenic
1037557305 8:20037489-20037511 ATAAACTAGGTATTGATGGAAGG - Intergenic
1042576764 8:70229425-70229447 CTGAGCTAGGTTTTGAAGAATGG + Intronic
1048802333 8:138206053-138206075 CTGAACTATGCATAGATGGCGGG - Intronic
1050235144 9:3569905-3569927 GTCAACTAGATTTAGATGAAAGG - Intergenic
1052131541 9:24854552-24854574 CAGAAATAGGTATAGATAGATGG - Intergenic
1052228118 9:26114389-26114411 CTGAAAGAGGTGAAGATGGAGGG + Exonic
1054914801 9:70485861-70485883 CTGAACTGGGTCTTGAAGGATGG - Intergenic
1057801708 9:98195128-98195150 CTGGACCAGGATTAGAGGGAGGG - Intergenic
1061733400 9:132634897-132634919 CTAAACTAGGATCAGATGGTAGG + Intronic
1185679995 X:1880705-1880727 CTGCACCATGTCTAGATGGAGGG + Intergenic
1186166899 X:6836236-6836258 GTGAACTGGGGTGAGATGGAGGG - Intergenic
1186319717 X:8411262-8411284 CTGAAATAGTTCTAGATAGATGG - Intergenic
1187855103 X:23629182-23629204 CTGAACTAGGCTTAAAAGTATGG + Intergenic
1191220507 X:57983437-57983459 ATAAAGTAGGTTTAGAAGGAAGG - Intergenic
1193318720 X:80095448-80095470 ATGAATTAGGTATTGATGGAAGG + Intergenic
1193343969 X:80384397-80384419 ATGAATTAGGTATTGATGGAAGG + Intronic
1193719119 X:84967544-84967566 ATTAACTAGGTATTGATGGAAGG - Intergenic
1193826729 X:86235427-86235449 ATGACCTAGGTGAAGATGGAAGG - Intronic
1195229922 X:102835997-102836019 CTGAACTAGTGTAAGCTGGAAGG + Intergenic
1197217067 X:123876362-123876384 CATAAGTAGGTTTAGATAGAAGG + Intronic
1197317250 X:124982403-124982425 CTAAACTAGGGTCAGCTGGAGGG - Intergenic
1197993942 X:132352078-132352100 CTGAAAGAGGTTTAGATGTGTGG + Intergenic
1198791150 X:140347737-140347759 CTGAGCTATTTTAAGATGGATGG - Intergenic
1201781336 Y:17725666-17725688 CAGAAATAAGTTTAGATTGAGGG - Intergenic
1201820217 Y:18180324-18180346 CAGAAATAAGTTTAGATTGAGGG + Intergenic
1202076934 Y:21045326-21045348 CTGAAGTATGTTTATATTGATGG - Intergenic