ID: 924167447

View in Genome Browser
Species Human (GRCh38)
Location 1:241299333-241299355
Sequence AAATGTATGAATCATCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924167447 Original CRISPR AAATGTATGAATCATCTAGG AGG (reversed) Intronic