ID: 924167447

View in Genome Browser
Species Human (GRCh38)
Location 1:241299333-241299355
Sequence AAATGTATGAATCATCTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924167447 Original CRISPR AAATGTATGAATCATCTAGG AGG (reversed) Intronic
906682600 1:47739676-47739698 AGATATGTGAATCATATAGGAGG - Intergenic
909292499 1:73901672-73901694 CCATGTATGATCCATCTAGGTGG - Intergenic
912147402 1:106809960-106809982 AAATGATTGAATCATCAGGGTGG + Intergenic
914892146 1:151635129-151635151 AAAGGTTTGTATCATCAAGGAGG + Intronic
917004635 1:170399809-170399831 ATATGTTTAAATCATCTAGCAGG - Intergenic
918354138 1:183689944-183689966 ACCTGTATGAATCATCTAGAGGG + Intronic
919596495 1:199570119-199570141 AAATGTATGAATTCTCTCTGGGG + Intergenic
924167447 1:241299333-241299355 AAATGTATGAATCATCTAGGAGG - Intronic
924352274 1:243127458-243127480 AGATGTAAGAATCATGTAGAAGG + Intronic
1064115000 10:12570316-12570338 AAAAATATCAATCATCTTGGAGG - Intronic
1064168721 10:13009779-13009801 AAAACTATAAAACATCTAGGAGG + Intronic
1065279110 10:24116627-24116649 AAATTTAAAAATCATCTAGAAGG - Intronic
1065322213 10:24520318-24520340 ACATGAATGAATCCTCTATGTGG - Intronic
1068001854 10:51344362-51344384 AAATGTTTGGATCATTGAGGTGG - Intronic
1068188750 10:53622026-53622048 AAATGTATGAATGATCTACATGG + Intergenic
1068492450 10:57741154-57741176 AAATGTATGAGACATCTAGAAGG - Intergenic
1069109245 10:64424826-64424848 AAGTGTATGAATTTTCTATGTGG - Intergenic
1073531286 10:104233944-104233966 CATTGTATGAAGCATTTAGGAGG - Intergenic
1077575465 11:3379385-3379407 AAATGTAAATATCCTCTAGGTGG - Intergenic
1086509037 11:87536193-87536215 AAATGTTTAAGTCATCTGGGTGG + Intergenic
1088937696 11:114420143-114420165 AAATGTATTAAGCATCTAAATGG - Intronic
1092025386 12:5235126-5235148 AAATGTAGCAATCATCTATGCGG - Intergenic
1094043474 12:26142178-26142200 AAATGTTTGATTTGTCTAGGTGG + Intronic
1094412261 12:30179070-30179092 TAAAGTATGACTCATTTAGGTGG + Intergenic
1095673131 12:44884317-44884339 AAATGTATGAAACATTTACCTGG + Intronic
1095707710 12:45255760-45255782 AGATGTATGATCCATCCAGGAGG - Intronic
1096142196 12:49251616-49251638 AAATGTAAAAATCAGCTGGGTGG + Intronic
1096286037 12:50301270-50301292 ATATGTATGCATGATCTAGGTGG + Intergenic
1096920132 12:55075238-55075260 TAGTCTATGAATCATTTAGGGGG - Intergenic
1098742977 12:74198878-74198900 AAATCTAGGAATCATTTTGGGGG - Intergenic
1099260818 12:80380252-80380274 AAATCTATGAATCATTTATTTGG - Intergenic
1100704157 12:97182065-97182087 AAGCTTATGAATCATCTAGACGG + Intergenic
1108145743 13:47474683-47474705 TAATGTAAGAATCAGATAGGAGG - Intergenic
1109351845 13:61192692-61192714 AAATGTATGCACAATCTAAGAGG - Intergenic
1109699418 13:66006223-66006245 AAATGTCTGAATTATCCACGTGG - Intergenic
1111269062 13:85856066-85856088 AAATGTATTAATGATCTTGTAGG - Intergenic
1111461149 13:88543825-88543847 AAATAAAATAATCATCTAGGTGG - Intergenic
1113178229 13:107592737-107592759 AAATGTATGAATGATCTGTTTGG - Intronic
1114705010 14:24715765-24715787 AACTGTAAGAATCAGCTATGTGG - Intergenic
1115442144 14:33448061-33448083 ATAAGTATGAATTATGTAGGAGG + Intronic
1115666697 14:35557918-35557940 AAAAGAAAGAATCATCTATGGGG + Intronic
1118716120 14:68561262-68561284 AAATTTAAGGATCATTTAGGGGG + Intronic
1119408703 14:74414615-74414637 AAATGTATGAGAGATTTAGGAGG + Intronic
1120154195 14:81074346-81074368 AAATGTATTAAACATTTGGGTGG - Intronic
1120312404 14:82846373-82846395 AGATGTTTGAATCAGGTAGGAGG - Intergenic
1121715947 14:96074919-96074941 AAATGTTTGAATCAGCTTGTTGG + Intronic
1122361147 14:101165503-101165525 AAATTTAAAAATCATTTAGGAGG - Intergenic
1202904206 14_GL000194v1_random:59240-59262 AAATGGATGAATCAACGAAGGGG - Intergenic
1124051540 15:26201257-26201279 AAATGTATGGAACGTCTGGGTGG + Intergenic
1126345257 15:47686906-47686928 AAATGAAAAAATCATCTAAGAGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1131828822 15:96341586-96341608 AAATGTTTGAATGGTATAGGGGG + Intergenic
1134503390 16:14786451-14786473 AAATGGATGAATCACCAAGGAGG + Intronic
1134577178 16:15342447-15342469 AAATGGATGAATCACCAAGGAGG - Intergenic
1134725266 16:16414046-16414068 AAATGGATGAATCACCAAGGAGG + Intergenic
1134942166 16:18297812-18297834 AAATGGATGAATCACCAAGGAGG - Intergenic
1135347792 16:21704211-21704233 AAATCTTTGCATCATCTGGGTGG + Intronic
1138085628 16:54131444-54131466 AAATGTCTGACTCATCACGGAGG + Intergenic
1138224993 16:55285541-55285563 AAATGTCTTTATCATCTTGGAGG + Intergenic
1138469411 16:57221235-57221257 AAATGTGTCAATCAACTATGAGG - Intronic
1203139210 16_KI270728v1_random:1748718-1748740 ATATCTATGTATCATCTGGGTGG - Intergenic
1144403416 17:14929010-14929032 AAAAGTATGAAGGATGTAGGAGG - Intergenic
1146357161 17:32143580-32143602 AAATGTATGAAATTTCTGGGTGG - Intronic
1146510822 17:33446750-33446772 AAATGAATGAATCCTCTGGAAGG + Intronic
1154237729 18:12622044-12622066 AGATGGATGAGTCATTTAGGTGG - Intronic
1155647203 18:28093680-28093702 AAATGTATTAATCATTTAACTGG - Intronic
1155677167 18:28442969-28442991 AAGTGTTTGAATCATACAGGTGG - Intergenic
1156159262 18:34340638-34340660 AAATGTATTAAACATCCAAGTGG - Intergenic
1158197031 18:54899179-54899201 AAATCAATCAATCATCTAGATGG + Intergenic
1161150870 19:2708224-2708246 AATTATCTGATTCATCTAGGTGG + Intergenic
1164082143 19:21867778-21867800 AAATGCAAAAATCATCTGGGGGG - Intergenic
1166336160 19:42108956-42108978 AAATGTATTGATCACCTATGAGG - Intronic
925564166 2:5231434-5231456 AAATGTACGTATGGTCTAGGCGG + Intergenic
925762563 2:7199607-7199629 ACATTTATTAATCATCTAGCAGG + Intergenic
925932931 2:8724596-8724618 AAGTGAATGAATAAACTAGGGGG - Intergenic
926570219 2:14521478-14521500 AAATTTGAGAATCATCTAGTTGG + Intergenic
928051621 2:28002998-28003020 AAAATTATAAATCATCTAGAGGG + Intronic
928963249 2:36951642-36951664 AAATGAATGAATCATATATTAGG - Intronic
930436283 2:51347723-51347745 AAATCTATGCAACATTTAGGAGG + Intergenic
933013926 2:77100415-77100437 AAAGGTATGATTCAACTCGGAGG - Intronic
933518539 2:83338537-83338559 AAATCTATGAATCAGATAAGGGG + Intergenic
935089011 2:99876268-99876290 AAATGGTTGTATCAGCTAGGCGG - Intronic
937278760 2:120703211-120703233 AAATGTGTGAATTATCCTGGGGG - Intergenic
939511908 2:143117465-143117487 AGATGAATGAATCATGTGGGTGG - Intronic
939733402 2:145813410-145813432 AAAGGTGGAAATCATCTAGGAGG - Intergenic
939760719 2:146174310-146174332 AAATGGATGAAGCAGCAAGGAGG - Intergenic
939849440 2:147286791-147286813 TAATGTATGAAGCATTTAGAGGG - Intergenic
941408245 2:165119061-165119083 AAATTTAAAAATCATCCAGGTGG - Intronic
942210958 2:173669634-173669656 GAATGGATGAATCATATAGCGGG - Intergenic
943672732 2:190680581-190680603 CAGTGTATGAATCAGCTGGGTGG + Intronic
945023896 2:205601766-205601788 AATTGCATGAATCTTCTAGATGG + Intronic
948056948 2:235015747-235015769 AAAGGTGTGAACCATCTGGGAGG + Intronic
1176623575 21:9074007-9074029 AAATGGATGAATCAACGAAGGGG - Intergenic
1177923402 21:27183442-27183464 AAATGTATGAATCACAAAGAAGG + Intergenic
1178600308 21:33988737-33988759 TTATGTATGAATCGTGTAGGAGG - Intergenic
1178736814 21:35160051-35160073 AAAGGTATGAGTCATCTACATGG + Intronic
1179630022 21:42671862-42671884 AAATGTGTGAATCTGCTAGTGGG + Intronic
1182747938 22:32620049-32620071 AAATCTATGAGTCAGCTAAGTGG - Intronic
949911343 3:8911093-8911115 AAATGTATGAATAAACTAAAAGG + Intronic
951049068 3:18074249-18074271 ATATTTTTGAATCAGCTAGGAGG + Intronic
951068034 3:18290434-18290456 ACATGTTAGAATCATCTGGGGGG + Intronic
951146373 3:19232730-19232752 AATTGTATGAAGCATCTGAGAGG + Intronic
952828818 3:37545985-37546007 AAATGTAAAAATCATGCAGGTGG - Intronic
953278440 3:41527980-41528002 AAATGTATGACACAGCTATGTGG + Intronic
955412614 3:58665577-58665599 CACTGGATGAATCATCTAGAAGG + Intronic
956824613 3:72986223-72986245 AAATGAATGAATGATTTGGGAGG + Intronic
957255354 3:77828787-77828809 ACATATTTGAATCTTCTAGGAGG + Intergenic
957739272 3:84242650-84242672 AAATGCATAAATCTTCTAGATGG - Intergenic
957821907 3:85387225-85387247 AATTATATGAATGATTTAGGGGG - Intronic
958116598 3:89227420-89227442 AAATGCATGATTCATCCATGAGG - Intronic
961852261 3:129832583-129832605 AAATCTATCAACCATTTAGGAGG + Intronic
964047533 3:152348038-152348060 AAATCTATGACTCATCCTGGAGG - Intronic
964626703 3:158766724-158766746 GAATTTAAGAATCATTTAGGAGG - Intronic
964887392 3:161500358-161500380 AAATGTATGAATCACTGGGGAGG - Intronic
965690508 3:171351775-171351797 AAATGTGTGATTCATCTCTGTGG + Intronic
971339585 4:25755598-25755620 AAATGTATGAAAGAACTATGGGG + Intronic
972931852 4:44081636-44081658 GAATTTATGGATCATCTAAGAGG - Intergenic
975911734 4:79275160-79275182 AAATATAGGAATCCTGTAGGAGG - Intronic
978177121 4:105745752-105745774 AACTATATAAATCATGTAGGAGG + Intronic
978267399 4:106842785-106842807 AAATGCATGAAGCATGAAGGAGG - Intergenic
978790767 4:112661381-112661403 AAGTGTATGAAAATTCTAGGAGG + Intergenic
979249670 4:118553067-118553089 AGATGTAAGAATCATGTAGAAGG - Intergenic
979704288 4:123703114-123703136 AAATGCATGGATCATGTAGCTGG + Intergenic
979848149 4:125543237-125543259 AAATGCAGAAATCATCTGGGTGG + Intergenic
980514025 4:133830340-133830362 AAATAAATAAAACATCTAGGTGG + Intergenic
981614812 4:146635300-146635322 AAATGTATGTGTTTTCTAGGAGG + Intergenic
982108438 4:152031530-152031552 AAATGCCTGAATCATCTATGTGG - Intergenic
989284998 5:39688608-39688630 AAAAGTATGGTACATCTAGGAGG - Intergenic
989544276 5:42654638-42654660 AAAGATATAAATCAACTAGGGGG + Intronic
990853731 5:60239054-60239076 AAATGTATGAAATATCTTTGTGG - Intronic
992043960 5:72866140-72866162 AAATGAATCCATCACCTAGGTGG + Intronic
992323050 5:75632930-75632952 AAATGAATGAATTATTTATGAGG + Intronic
993346164 5:86785667-86785689 AAATGTATATATCATATATGTGG + Intergenic
994417560 5:99493200-99493222 AAATGTATAAATACTCTAAGTGG + Intergenic
994462403 5:100081968-100081990 AAATGTATAAATACTCTAAGTGG - Intergenic
995218015 5:109617302-109617324 AAATGTATGAATGCGCTAGAGGG + Intergenic
998081867 5:139282336-139282358 AAATTTATGACTCATCAAGTTGG - Intronic
998640834 5:144009266-144009288 AATTGTATGTATGATCAAGGTGG - Intergenic
1001268420 5:170292218-170292240 GAATGAATGAATGATTTAGGTGG + Intronic
1001504995 5:172271569-172271591 AAATGTATGATTCCTCCAGTAGG + Intronic
1007527838 6:42512219-42512241 AAATGTGTGAATCATCTCCGCGG + Intergenic
1012042086 6:94219532-94219554 AAATGAATGGAACATCTAGAAGG + Intergenic
1013621298 6:111892103-111892125 AAATCTATGATTCAGATAGGAGG - Intergenic
1013900456 6:115149869-115149891 AAATATAAAAATGATCTAGGTGG - Intergenic
1014637199 6:123862202-123862224 AAATATATGAAGCATTTATGGGG + Intronic
1014675108 6:124354345-124354367 AAATGTATGAAGCATCCAGAAGG - Intronic
1018630042 6:165814408-165814430 AAATGTATGAATCGTTTTGGAGG - Intronic
1023047310 7:36221697-36221719 AAAGGTAAGAATCATGTATGAGG + Intronic
1024439745 7:49403604-49403626 AAATGCATGAATAACCTATGAGG + Intergenic
1024960656 7:54971176-54971198 AAATATTTGTATAATCTAGGTGG - Intergenic
1026706328 7:72696419-72696441 AAATGCATAAAACTTCTAGGTGG - Intronic
1028006948 7:85584896-85584918 AAATGTATGAATCAATTTAGAGG - Intergenic
1028776485 7:94683240-94683262 AAATGTATGAATCACTGAGATGG - Intergenic
1029314663 7:99700479-99700501 ATGTGTAGGAGTCATCTAGGGGG - Intronic
1035907082 8:3524991-3525013 TAATGTATGTATCATCAAGTTGG + Intronic
1035998926 8:4580117-4580139 AAATGTATTAAACACCTATGTGG + Intronic
1039263520 8:35799447-35799469 AAATGTATGGTTCAGCTGGGAGG + Intergenic
1042355907 8:67827316-67827338 AAATGTATTAATCATTTATAGGG - Intergenic
1047086822 8:121526582-121526604 AAATTTCTGAATCATATTGGTGG + Intergenic
1047882436 8:129211106-129211128 AATTGCATGAATGATTTAGGGGG - Intergenic
1048286385 8:133145086-133145108 AGATTTCTGAATCATCTAGTTGG + Intergenic
1048892882 8:138963576-138963598 AAAAGTCTCAATCATTTAGGAGG + Intergenic
1048985412 8:139732266-139732288 AAATGAATGAATCAGCGAGTGGG - Intronic
1050855265 9:10346358-10346380 AAATGAATCAATCAACTAGGAGG + Intronic
1052051799 9:23857597-23857619 AATTGTATTAATCATGGAGGGGG + Intergenic
1052445701 9:28558291-28558313 AAATGTATGAATCTTCTGTAGGG - Intronic
1052527656 9:29639858-29639880 AAATTTATGAATTATAGAGGAGG + Intergenic
1055876698 9:80952077-80952099 AAATGTGTGAATCAATTAAGAGG + Intergenic
1058234364 9:102470852-102470874 AAATGTTTGAGTCATAGAGGTGG - Intergenic
1058462949 9:105199843-105199865 AACTGTATAAATCATTTTGGGGG + Intergenic
1203746759 Un_GL000218v1:44435-44457 AAATGGATGAATCAACGAAGGGG - Intergenic
1203563345 Un_KI270744v1:75045-75067 AAATGGATGAATCAACGAAGAGG + Intergenic
1185961903 X:4553583-4553605 AAATATATGAAACATATAGGAGG + Intergenic
1186129168 X:6447944-6447966 AAAAGGAGGAGTCATCTAGGTGG + Intergenic
1186341315 X:8649170-8649192 TAATTTATGAAACATCTTGGAGG - Intronic
1187382455 X:18816594-18816616 TAATGGATGAAACAACTAGGTGG - Intronic
1187973643 X:24683488-24683510 AATGGTATCAATCTTCTAGGGGG + Intergenic
1194582519 X:95693964-95693986 AACTGTATGTTTCATCTGGGAGG + Intergenic
1194821987 X:98520542-98520564 AAATGTATTAAACATCTGGAAGG + Intergenic
1195390798 X:104360111-104360133 AAATGTATACATCATCTAAGGGG + Intergenic
1198662659 X:138987032-138987054 AAATGTATGAATCATTCTGAAGG + Intronic
1198777775 X:140199071-140199093 AAATGTAATAAGCATCTAGAAGG - Intergenic
1199037612 X:143071746-143071768 AAATGTATGTATCTTTTTGGTGG - Intergenic
1200288678 X:154849905-154849927 AAATCCATGTATTATCTAGGAGG - Intronic
1200764220 Y:7066810-7066832 AAATGTAGAAATCAGCCAGGTGG + Intronic