ID: 924167923

View in Genome Browser
Species Human (GRCh38)
Location 1:241304562-241304584
Sequence AAGCAAATCACTCAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924167923 Original CRISPR AAGCAAATCACTCAGCAGGA GGG Intronic
902600122 1:17535361-17535383 AACCAGGTCACACAGCAGGAGGG - Intergenic
902679396 1:18032362-18032384 CAGCAAAGCACTCAGCATAATGG + Intergenic
903453272 1:23469582-23469604 GAGCAGATCACCCAACAGGAAGG + Intronic
905663424 1:39746359-39746381 ATGCAAAACCCCCAGCAGGATGG - Intronic
906484063 1:46221011-46221033 AATGACATCACTCAGCAGGTAGG - Exonic
906506684 1:46385015-46385037 AAGAAAATTTCTCAGCAAGAAGG - Intergenic
908164897 1:61448404-61448426 AAGCAAATCACTCTACAAGGCGG - Intronic
909107885 1:71435461-71435483 AAGGAAATCACTAAGGAGAAAGG + Intronic
912388052 1:109282438-109282460 AAGCCAATAATTCAGCAGTAAGG + Intronic
914460926 1:147884308-147884330 AAGAAAATCATACTGCAGGAGGG - Intergenic
916201018 1:162271857-162271879 AAGGGAAGCACACAGCAGGAAGG - Intronic
917656960 1:177136104-177136126 GAGCAAATTATTCAGTAGGATGG - Intronic
917660037 1:177169283-177169305 AAGTAAATAACTCAGCAGTTGGG + Intergenic
918149579 1:181786568-181786590 AGGCTTATCACTCAGAAGGATGG - Intronic
921773941 1:219075167-219075189 AATCAAATCAATCATCAGGATGG - Intergenic
923186867 1:231582224-231582246 AAGCAAATCCCTTAGCAACATGG - Intronic
924015285 1:239714587-239714609 AAACACATAACACAGCAGGAAGG + Intronic
924167923 1:241304562-241304584 AAGCAAATCACTCAGCAGGAGGG + Intronic
1063561610 10:7133555-7133577 AAGAAAATCATTTAACAGGACGG - Intergenic
1063669347 10:8087448-8087470 AAGGCAACCACTCAGCAGAAAGG - Intergenic
1064430522 10:15266558-15266580 AAGAAAAACACTCAGAAGGGAGG + Intronic
1066239742 10:33522140-33522162 AAGCAAGTCAGTGAGCAAGATGG + Intergenic
1066668538 10:37812250-37812272 AAGAAAATCATTGAGGAGGAAGG + Intronic
1068205696 10:53849523-53849545 AAGCAAATCACTTATCAAGTAGG - Intronic
1068260005 10:54567860-54567882 AAGGAAATAGCACAGCAGGAAGG - Intronic
1072087523 10:92095111-92095133 AATGAAAGCTCTCAGCAGGAAGG - Intronic
1074383345 10:112997705-112997727 ATGGAAATTACTCAGAAGGAAGG - Intronic
1074442138 10:113487398-113487420 AATCAAATCAGCCAGCAGGTGGG - Intergenic
1075397876 10:122141057-122141079 AAGGAGGTGACTCAGCAGGAAGG + Intronic
1077398596 11:2340633-2340655 AAGGAAATTTCTCAGCAAGAAGG + Intergenic
1078425123 11:11243606-11243628 AAGAAAGTCACCCAGCAGTAGGG + Intergenic
1078461087 11:11515807-11515829 GAGCAGATCACTGGGCAGGAAGG + Intronic
1080111587 11:28574183-28574205 ATGCAAATATCTCAGCAGGAAGG + Intergenic
1080686706 11:34522089-34522111 CAGCAAATCACTCTGCAGAGTGG + Intergenic
1084586823 11:70067229-70067251 AAGCAAATGACACGGCAGGTGGG - Intergenic
1085092782 11:73732797-73732819 AAGAAAATCACTGAGGAGAAAGG - Intronic
1085696062 11:78705658-78705680 AAGAAAATCACTCTGCAACAAGG - Intronic
1085896263 11:80642954-80642976 AAAAAAACCACTCAGCAGAAGGG - Intergenic
1086560573 11:88163883-88163905 AAGCAAATAACTCATGTGGATGG + Intronic
1086566608 11:88234009-88234031 GAGCAAATCTCACAGCAGGAGGG - Intergenic
1086861088 11:91925807-91925829 AAGCAAAGCGCTCAGAAGAATGG - Intergenic
1088116603 11:106319688-106319710 ATGTAAATGACCCAGCAGGATGG + Intergenic
1088923170 11:114276448-114276470 AAGCAAATGAGGTAGCAGGATGG - Intronic
1089772766 11:120815327-120815349 AAGCAAAGCACTCATCAGGTCGG - Intronic
1090152004 11:124394623-124394645 GAGCCAATGACTCAGCAGGGTGG - Intergenic
1090685444 11:129112578-129112600 AAGAAAATCACTGAGAAGAAAGG - Intronic
1091027945 11:132158846-132158868 GAACAAATCACACAGCAGGAAGG + Intronic
1091188748 11:133671446-133671468 AAGAAAATCACTCCCCAGGCAGG + Intergenic
1093131340 12:15394980-15395002 AAGAAAAACACTCAGCAAAAGGG + Intronic
1093601310 12:21027608-21027630 AAGAAAATCACTGAGAAGAAAGG + Intronic
1094029850 12:25999088-25999110 AAGAAAATGACACAGCAGTATGG + Intronic
1094188481 12:27671233-27671255 AAGGAAATCATTCTGGAGGAAGG - Intronic
1095740929 12:45606335-45606357 AGGCCTACCACTCAGCAGGAAGG + Intergenic
1098248316 12:68543198-68543220 AAGGAAATTACTCAGTAGAAAGG + Intergenic
1100356589 12:93836802-93836824 GAGTACATCACTGAGCAGGATGG + Intronic
1101135733 12:101741088-101741110 AAGCAAAACAGTAAACAGGAGGG - Intronic
1101473576 12:105022101-105022123 AAGTAAATCACCTAGCAGGCTGG + Exonic
1101667671 12:106834454-106834476 AAGCAAATGAGTGACCAGGAAGG + Intronic
1103672510 12:122629613-122629635 AACCAAAGTACTCATCAGGAGGG + Intergenic
1104197499 12:126554937-126554959 AAGTAAAACACTCAGTAGGGAGG + Intergenic
1105812431 13:24007225-24007247 AAACATGTCACTCAGCAGAAGGG - Intronic
1106691145 13:32118013-32118035 AAACAAAATACTCAGCTGGAAGG - Intronic
1109128502 13:58549493-58549515 AAGCAAAGCTCTCAGAAGGGTGG - Intergenic
1110853893 13:80276592-80276614 AGGCAGAACACTCAACAGGAAGG - Intergenic
1112067423 13:95808472-95808494 AAGAAAATCACTGAGGAGAAAGG - Intronic
1112331603 13:98481297-98481319 AAGCAAATCACAGACCAGGACGG + Intronic
1116537108 14:46045871-46045893 AAGAAAATCACTTAACATGAAGG - Intergenic
1116960067 14:50960057-50960079 TAGCAAATCACTAAACATGAGGG + Intergenic
1117408019 14:55423565-55423587 AACAAAATCAGGCAGCAGGATGG - Intronic
1121071788 14:91030001-91030023 AGGTAAATGACTCAGCAGAATGG + Intronic
1121679670 14:95782924-95782946 AAGCAAGTCACTCAAGGGGAGGG - Intergenic
1124614175 15:31229589-31229611 AAGCAAAGCACCCTGCAGTAGGG + Intergenic
1129169797 15:73800669-73800691 AAGAAAATCGCACAGAAGGAGGG - Intergenic
1130408298 15:83622985-83623007 AAGCAATGCAGGCAGCAGGAGGG - Intergenic
1131674190 15:94654647-94654669 AAGCAAATCATTTACCATGAAGG + Intergenic
1135167844 16:20156422-20156444 AAGCAAAGCACTCAAGAGGTGGG - Intergenic
1136743629 16:32562777-32562799 AAACAAATCCCTCAGGAGGCTGG - Intergenic
1137600864 16:49755222-49755244 AAGCAAATAACAAAGCAGGCGGG + Intronic
1138396581 16:56709314-56709336 AACAAAATCAGTCAGCAGAAAGG + Intronic
1138662894 16:58535488-58535510 GAGCAAATAAGCCAGCAGGAAGG + Intronic
1138717984 16:59046254-59046276 AAGCAAATAACCCAGCAAAAAGG - Intergenic
1139707955 16:68754867-68754889 AAGAATAAAACTCAGCAGGAAGG + Intronic
1203025970 16_KI270728v1_random:512452-512474 AAACAAATCCCTCAGGAGGCTGG + Intergenic
1203045751 16_KI270728v1_random:821979-822001 AAACAAATCCCTCAGGAGGCTGG - Intergenic
1142500187 17:327951-327973 GAGCACGTCACCCAGCAGGAGGG + Intronic
1144712563 17:17411708-17411730 AAGCAAATTACAAAGCAGAATGG - Intergenic
1145925076 17:28640789-28640811 AAGCAAATGCCTAAGCTGGATGG + Intronic
1146611094 17:34305578-34305600 AAGCAGAGCACTCAGAAGCATGG + Intergenic
1148730989 17:49836459-49836481 AAAGAATTCACTCACCAGGATGG + Intergenic
1149494282 17:57107161-57107183 AAGCAGATCATTCAGGAGGTAGG + Exonic
1149600942 17:57892585-57892607 AAGCAAATCCCTCTGCAGGCAGG - Intronic
1149633592 17:58148143-58148165 AACCAAATCCCTCAGCACCATGG - Intergenic
1149680944 17:58506869-58506891 AATCTAAACACACAGCAGGAAGG + Exonic
1150972727 17:70047735-70047757 CAGCTAATAAATCAGCAGGAAGG - Intergenic
1152155266 17:78628898-78628920 CAGCACATCACTCAGCATGGAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155231961 18:23782941-23782963 AAGTAAATCACCCAGCAGACTGG - Intronic
1155410046 18:25533818-25533840 ACTCAAATCACTCAGCAAGTAGG + Intergenic
1155803800 18:30141553-30141575 AAGGAAATGACACAGCAGCAGGG - Intergenic
1156584338 18:38415212-38415234 AAGGACATCATTCAGCAGAAGGG - Intergenic
1157127211 18:44968042-44968064 CTGCAAATTGCTCAGCAGGATGG + Intronic
1157462240 18:47909427-47909449 AAGAAAATCACTGAGGAGAAAGG + Intronic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1163600717 19:18247666-18247688 ACTCACTTCACTCAGCAGGAAGG + Intronic
1164891526 19:31827720-31827742 GAGGAAATCACTCAGAAAGATGG - Intergenic
1166002100 19:39883550-39883572 AGGGACATCTCTCAGCAGGATGG + Intronic
1166004884 19:39899801-39899823 AGGGACATCTCTCAGCAGGATGG + Intronic
1166100920 19:40570893-40570915 AAGCCAACCAATGAGCAGGAGGG + Intronic
1167906816 19:52667978-52668000 AAGAAAATTTCTCAGCAAGAAGG + Intronic
924990900 2:312277-312299 AAGCAAGTCACTCTGGAGGATGG - Intergenic
925080787 2:1063479-1063501 AAGGAAAGCTTTCAGCAGGATGG + Intronic
925205639 2:2003490-2003512 AATCAAGCCACACAGCAGGAGGG - Intronic
926503279 2:13680688-13680710 AAGGAAATGTCTCAGCAAGAAGG + Intergenic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
927676420 2:25109975-25109997 AAGCGAGTCACCCAGCAGGTTGG + Intronic
928402742 2:30991127-30991149 AAGTAATTCACTGAGCAGGCAGG - Intronic
929215489 2:39407503-39407525 AAGAAAATCATTCAGGAGAAAGG + Intronic
930634061 2:53786008-53786030 AACCAAATCAAAAAGCAGGAAGG - Intronic
931118454 2:59190111-59190133 AAGCAAGCCACTCAGGAAGAAGG - Intergenic
931550383 2:63438699-63438721 AAGAAAAGAACTCTGCAGGATGG - Intronic
934557710 2:95296291-95296313 AAGCAAACCACTCAGGAGCCAGG - Intergenic
936476735 2:112846090-112846112 GAGCAAAACAGTCTGCAGGACGG - Intergenic
936706583 2:115082226-115082248 AAGCAAAGACCTTAGCAGGAAGG - Intronic
936869805 2:117122499-117122521 AACCAAATCTCTCAGCAATAGGG - Intergenic
937097487 2:119245231-119245253 GAGGAAATCATTCAGCAGGAGGG + Intronic
938671580 2:133591302-133591324 AACACATTCACTCAGCAGGAAGG - Intergenic
939062566 2:137440740-137440762 AAGCAAATAAGTAAGCAGGTAGG + Intronic
939445215 2:142301521-142301543 AAGAAAATCACTCTGTTGGAAGG - Intergenic
940951647 2:159682156-159682178 AAGCAAAGAAAACAGCAGGAGGG - Intergenic
941163364 2:162059783-162059805 AGGCAAAACATTCAGCAGTATGG + Intronic
941177325 2:162214715-162214737 AAGGAAATCACAAAGCTGGAAGG + Intronic
942408912 2:175685939-175685961 AAGCAAATAACTCAGGAGTGTGG + Intergenic
942778066 2:179608436-179608458 CAGCAGGTCACTCAGCAGGTGGG - Intronic
945318988 2:208399785-208399807 TAGCAAATCATTAAGCATGATGG + Intronic
945480546 2:210339977-210339999 AAGCAAATATGGCAGCAGGAAGG + Intergenic
947261214 2:228224524-228224546 AAGCAAAGCAGTTAACAGGAAGG + Intergenic
948674051 2:239586855-239586877 ACTCAAATCACCCAGAAGGACGG - Intergenic
1169181572 20:3573653-3573675 AAGCAAAGCAGGCAGAAGGACGG - Intronic
1169865990 20:10200526-10200548 AAGCAAGTGACTCAGCAAGCTGG - Intergenic
1170960507 20:21021205-21021227 AATCACATCACTCAGAAGGAAGG + Intergenic
1172345516 20:34195506-34195528 AGGCACAACCCTCAGCAGGAGGG + Intronic
1174645597 20:52082666-52082688 GAGCAAAGTACTCTGCAGGAGGG + Intronic
1175465345 20:59186892-59186914 CAGCACATCACTGAGCAGAAGGG - Intergenic
1177081568 21:16644840-16644862 AAAGAAATTACTCAACAGGAGGG + Intergenic
1178274125 21:31220928-31220950 CTGCAAATCACTCAGCATTATGG + Intronic
1179303669 21:40135626-40135648 AAGAAAAACAATGAGCAGGAAGG - Intronic
1183122041 22:35737624-35737646 AAGCAAAGCACCGAGCAGGTGGG + Intergenic
949433314 3:4002016-4002038 AAGCAAATCACATAGCAAGAGGG + Intronic
949439508 3:4065695-4065717 ATGCAAATCACTCAGTACAATGG - Intronic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
949951172 3:9229835-9229857 AAGCAGAGCGCTTAGCAGGAGGG - Intronic
950678166 3:14567174-14567196 ATGCAACTCACTCAGCAGTGAGG + Intergenic
953165212 3:40458831-40458853 ATGCAAATCCCTCTTCAGGATGG - Intronic
953726531 3:45404099-45404121 AAGCAAATCAAGCCACAGGATGG - Intronic
954289492 3:49642235-49642257 AAGCAAAATAGTCAGCAGGGTGG - Intronic
954874269 3:53791163-53791185 AAGCAAAGCACTCCTCCGGAAGG + Intronic
954884631 3:53861772-53861794 AAGAAAATCACTGAGGAGAAAGG + Intronic
957422153 3:79984935-79984957 AAGCAGGTCACAGAGCAGGAAGG + Intergenic
957697995 3:83668597-83668619 AAACAGATCACTCAGCCTGAGGG - Intergenic
959760437 3:109956775-109956797 GAGCAAATCATTAAGAAGGAAGG - Intergenic
960211068 3:114966946-114966968 AAGCAAAGAACTCTTCAGGAAGG - Intronic
960988383 3:123295115-123295137 ATGCAAAATACTCAGCAGAAGGG + Intronic
962097294 3:132305644-132305666 AAGGAAATTTCTCAGCAGAAAGG + Intergenic
965490854 3:169334002-169334024 AAAGAAAACACTCAGAAGGAAGG - Intronic
968410328 4:384815-384837 AAGGAAAGCTCTCAGCAGAAAGG - Intronic
968876593 4:3271035-3271057 AAGCAATTCACAGAACAGGAGGG + Intronic
968978217 4:3832963-3832985 AAGGAAATGGCTCAGGAGGAGGG + Intergenic
970200430 4:13599421-13599443 CAGCAAGTTATTCAGCAGGAAGG - Exonic
970876091 4:20871630-20871652 AAGAAAATAACTGAGCAGCATGG + Intronic
970968429 4:21953773-21953795 AAAGAAATCACTCAGAAGAAAGG + Intergenic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
973078269 4:45958343-45958365 CTGCAAATCACTCTGCAAGAAGG - Intergenic
976314117 4:83641169-83641191 GAGCAAATAACTAAGCAGTAAGG + Intergenic
980527498 4:134011833-134011855 AAGCAAATACTTAAGCAGGATGG + Intergenic
980903227 4:138924689-138924711 AAGCAAGTCTCCCAGCAGGAAGG + Intergenic
983830429 4:172320284-172320306 AAGCTAAGCACTCAGGAAGAGGG - Intronic
984143134 4:176027622-176027644 AAAGAAATCACTGAGCATGATGG - Intergenic
991305994 5:65176870-65176892 AAGGAAATTTCTCAGTAGGAAGG + Intronic
992386871 5:76293083-76293105 AACCAAGTCACCCAGCAGAATGG - Intronic
993055170 5:82972360-82972382 AAGAAAATTTCTCAGCAAGAAGG - Intergenic
993230020 5:85223254-85223276 AAGCAAATAACTCATCAAGAGGG - Intergenic
996101107 5:119446835-119446857 AAGGAAATTTCTCAGCAGGGAGG + Intergenic
996128138 5:119749990-119750012 AAGCAAATCAAGCAGTATGAGGG - Intergenic
996206867 5:120750093-120750115 TAGCAAAACATTCAGCAGTATGG + Intergenic
998244849 5:140490776-140490798 AAGGAAATTACTCCTCAGGAGGG - Intronic
998481077 5:142463456-142463478 AAGCAGGTCACTCAGCATGCAGG + Intergenic
999232205 5:150068343-150068365 AAGCAAAGCAGTGAGCAGGCAGG + Intronic
999571247 5:152922250-152922272 AAACAAATTACTCAGTAGGGAGG + Intergenic
999882881 5:155886818-155886840 GCAAAAATCACTCAGCAGGAAGG + Intronic
1002596657 5:180328212-180328234 AATAAAATCACTTAGCTGGAGGG - Intronic
1002999200 6:2315146-2315168 AAGGAAATTTCTCAGCAAGAAGG - Intergenic
1010020240 6:71151533-71151555 AAAAAAATCACTCAGCTGAAGGG - Intergenic
1012505700 6:99943942-99943964 AAGAGAATCCCTCAGCAGGAAGG + Intronic
1014458537 6:121667003-121667025 AAACAAAGCTCTCAGCAGGCAGG - Intergenic
1015487943 6:133792700-133792722 AAGGAAATCACTCATCAGCCTGG - Intergenic
1016737726 6:147498170-147498192 AACAAAATCATTCAGGAGGAGGG - Intergenic
1017649475 6:156567820-156567842 AAGAAAGTCACTCTGAAGGATGG + Intergenic
1018191460 6:161312553-161312575 AAGAAAATTTCTCAGCAAGAAGG - Intergenic
1018215185 6:161519369-161519391 ACGCCAATTACTCTGCAGGATGG + Intronic
1019163591 6:170084897-170084919 CAGCAAATCACACAGGAGCAGGG + Intergenic
1019184196 6:170211624-170211646 AAGAAAGACACGCAGCAGGAAGG + Intergenic
1022162247 7:27723150-27723172 AAACAAGCCAGTCAGCAGGATGG + Intergenic
1022433548 7:30354346-30354368 AAGCAAAGGCCTCAGCAAGAAGG - Intronic
1022949847 7:35327604-35327626 AAGAAAATCAATCAGTAAGATGG - Intergenic
1023769874 7:43546978-43547000 AAGAAAATCACTGAGGAGAAAGG - Intronic
1023887691 7:44372918-44372940 CAGTGAATCACTCAGCATGAAGG + Intergenic
1026011233 7:66638240-66638262 CAGCACATCTCTAAGCAGGAAGG - Exonic
1027168463 7:75852971-75852993 AAGCAAAGCACTCACCAAGAGGG - Intronic
1028272457 7:88809434-88809456 AATCAAATAGCTCAGAAGGAAGG - Intronic
1028793680 7:94880917-94880939 AAGAAAATTTCTCAGCAAGAAGG + Intergenic
1030126201 7:106154708-106154730 AATCATATAACTCAGAAGGAGGG + Intergenic
1032656791 7:133939100-133939122 AAGCAAAAGAAACAGCAGGAAGG + Intronic
1032882136 7:136101080-136101102 AAAAAAAAAACTCAGCAGGAAGG + Intergenic
1036598761 8:10240039-10240061 AAGCAACTCACTTTGCAGCAAGG - Intronic
1037246067 8:16836485-16836507 AAGCAAATTACTCAAGGGGAGGG + Intergenic
1037383219 8:18310495-18310517 AATCAAATCACATAGCAGCACGG + Intergenic
1038163815 8:25065443-25065465 AAGCAAAGCACTAGGCAGAAAGG + Intergenic
1038315650 8:26482398-26482420 AGGCAGATGACTCAGCAGGAGGG - Intronic
1040694995 8:49985698-49985720 CTGCAAATAACTCAGCAGAAGGG + Intronic
1040788303 8:51193736-51193758 AATGAAATTACTCAGCATGAAGG - Intergenic
1044485873 8:92753623-92753645 AAGAAAAGCACTCAGAAGGAAGG - Intergenic
1044936073 8:97294415-97294437 AAGCAGATGACTCAGCAAAATGG + Intergenic
1045725439 8:105167661-105167683 AATCAAATCACCCAGGAGTATGG - Intronic
1045966295 8:108028600-108028622 AAGCAAATTCCTAAGAAGGATGG - Intronic
1047416233 8:124666873-124666895 AAGAAAATCCATCAGCAGTAGGG + Intronic
1048933992 8:139340215-139340237 AAGCAAATCAATCAGGAAGTGGG - Intergenic
1051554995 9:18373374-18373396 AAGCCAACCACTCTGCTGGATGG + Intergenic
1052345673 9:27407419-27407441 AAGCAACTCACTCAGAAGTGTGG + Intronic
1060356881 9:122917033-122917055 TAGCAAATCACTCACTTGGATGG + Exonic
1061050093 9:128190345-128190367 AAGCAAAGCTCTCTGCAGCATGG + Exonic
1062156160 9:135049821-135049843 AAGCAAATCTTGCAGGAGGAAGG - Intergenic
1185838482 X:3367455-3367477 GTGGAAATCACCCAGCAGGAGGG + Intergenic
1187062064 X:15796001-15796023 AAGAAAATCACTGAGGAGAAAGG - Intronic
1187821960 X:23297404-23297426 AAGCCAAGAACTCAGCAGGGTGG - Intergenic
1187884258 X:23874640-23874662 CTGCAAATTACTCAGCAGAATGG + Intronic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1190772163 X:53524193-53524215 AAGAAAATCACTGAGGAGAAAGG + Intergenic
1193249542 X:79272843-79272865 AAGCATGTCACAGAGCAGGAAGG - Intergenic
1200844950 Y:7822558-7822580 TATCAAATCACTCAACAGGTGGG + Intergenic
1201308834 Y:12576145-12576167 AAGCAAATTTCTCAGTAGAAAGG + Intergenic