ID: 924173897

View in Genome Browser
Species Human (GRCh38)
Location 1:241369696-241369718
Sequence CTCTCTCTGCAGTGGCTCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924173897_924173900 -9 Left 924173897 1:241369696-241369718 CCGTTGAGCCACTGCAGAGAGAG No data
Right 924173900 1:241369710-241369732 CAGAGAGAGAGAGAGAGGCCAGG No data
924173897_924173901 -8 Left 924173897 1:241369696-241369718 CCGTTGAGCCACTGCAGAGAGAG No data
Right 924173901 1:241369711-241369733 AGAGAGAGAGAGAGAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924173897 Original CRISPR CTCTCTCTGCAGTGGCTCAA CGG (reversed) Intergenic
No off target data available for this crispr