ID: 924173900

View in Genome Browser
Species Human (GRCh38)
Location 1:241369710-241369732
Sequence CAGAGAGAGAGAGAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924173897_924173900 -9 Left 924173897 1:241369696-241369718 CCGTTGAGCCACTGCAGAGAGAG No data
Right 924173900 1:241369710-241369732 CAGAGAGAGAGAGAGAGGCCAGG No data
924173896_924173900 -8 Left 924173896 1:241369695-241369717 CCCGTTGAGCCACTGCAGAGAGA No data
Right 924173900 1:241369710-241369732 CAGAGAGAGAGAGAGAGGCCAGG No data
924173894_924173900 3 Left 924173894 1:241369684-241369706 CCTGACATCTCCCCGTTGAGCCA No data
Right 924173900 1:241369710-241369732 CAGAGAGAGAGAGAGAGGCCAGG No data
924173895_924173900 -7 Left 924173895 1:241369694-241369716 CCCCGTTGAGCCACTGCAGAGAG No data
Right 924173900 1:241369710-241369732 CAGAGAGAGAGAGAGAGGCCAGG No data
924173892_924173900 28 Left 924173892 1:241369659-241369681 CCAGGATATACTTAAGGGAAGAG No data
Right 924173900 1:241369710-241369732 CAGAGAGAGAGAGAGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924173900 Original CRISPR CAGAGAGAGAGAGAGAGGCC AGG Intergenic
No off target data available for this crispr