ID: 924173901

View in Genome Browser
Species Human (GRCh38)
Location 1:241369711-241369733
Sequence AGAGAGAGAGAGAGAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924173896_924173901 -7 Left 924173896 1:241369695-241369717 CCCGTTGAGCCACTGCAGAGAGA No data
Right 924173901 1:241369711-241369733 AGAGAGAGAGAGAGAGGCCAGGG No data
924173892_924173901 29 Left 924173892 1:241369659-241369681 CCAGGATATACTTAAGGGAAGAG No data
Right 924173901 1:241369711-241369733 AGAGAGAGAGAGAGAGGCCAGGG No data
924173895_924173901 -6 Left 924173895 1:241369694-241369716 CCCCGTTGAGCCACTGCAGAGAG No data
Right 924173901 1:241369711-241369733 AGAGAGAGAGAGAGAGGCCAGGG No data
924173897_924173901 -8 Left 924173897 1:241369696-241369718 CCGTTGAGCCACTGCAGAGAGAG No data
Right 924173901 1:241369711-241369733 AGAGAGAGAGAGAGAGGCCAGGG No data
924173894_924173901 4 Left 924173894 1:241369684-241369706 CCTGACATCTCCCCGTTGAGCCA No data
Right 924173901 1:241369711-241369733 AGAGAGAGAGAGAGAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924173901 Original CRISPR AGAGAGAGAGAGAGAGGCCA GGG Intergenic
No off target data available for this crispr