ID: 924179051

View in Genome Browser
Species Human (GRCh38)
Location 1:241423433-241423455
Sequence ACCTGGGTATGTAGTCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924179051_924179058 18 Left 924179051 1:241423433-241423455 CCCTTTTGACTACATACCCAGGT No data
Right 924179058 1:241423474-241423496 CGTCTCTATATATTTGCCTTTGG No data
924179051_924179060 20 Left 924179051 1:241423433-241423455 CCCTTTTGACTACATACCCAGGT No data
Right 924179060 1:241423476-241423498 TCTCTATATATTTGCCTTTGGGG No data
924179051_924179061 21 Left 924179051 1:241423433-241423455 CCCTTTTGACTACATACCCAGGT No data
Right 924179061 1:241423477-241423499 CTCTATATATTTGCCTTTGGGGG No data
924179051_924179059 19 Left 924179051 1:241423433-241423455 CCCTTTTGACTACATACCCAGGT No data
Right 924179059 1:241423475-241423497 GTCTCTATATATTTGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924179051 Original CRISPR ACCTGGGTATGTAGTCAAAA GGG (reversed) Intergenic
No off target data available for this crispr