ID: 924182025

View in Genome Browser
Species Human (GRCh38)
Location 1:241448444-241448466
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924182025_924182028 30 Left 924182025 1:241448444-241448466 CCTATAGATGTGAGTGCACATGG No data
Right 924182028 1:241448497-241448519 GAGCCTCTGTTTCTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924182025 Original CRISPR CCATGTGCACTCACATCTAT AGG (reversed) Intergenic