ID: 924182508

View in Genome Browser
Species Human (GRCh38)
Location 1:241453247-241453269
Sequence AGTTATTTGCAGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924182505_924182508 20 Left 924182505 1:241453204-241453226 CCCAGTAGCAGGCCAAGAACTGT No data
Right 924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG No data
924182507_924182508 8 Left 924182507 1:241453216-241453238 CCAAGAACTGTCTCTCAAGAAAA No data
Right 924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG No data
924182506_924182508 19 Left 924182506 1:241453205-241453227 CCAGTAGCAGGCCAAGAACTGTC No data
Right 924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924182508 Original CRISPR AGTTATTTGCAGAAGATAGC AGG Intergenic
No off target data available for this crispr