ID: 924183077

View in Genome Browser
Species Human (GRCh38)
Location 1:241458737-241458759
Sequence ACGAATAAGCAGAAACTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924183075_924183077 12 Left 924183075 1:241458702-241458724 CCTGTGTGAGCTGGAGTTACGTG No data
Right 924183077 1:241458737-241458759 ACGAATAAGCAGAAACTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924183077 Original CRISPR ACGAATAAGCAGAAACTATA AGG Intergenic
No off target data available for this crispr