ID: 924185191

View in Genome Browser
Species Human (GRCh38)
Location 1:241481318-241481340
Sequence CTGTGGCAGGCACTGTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924185191_924185196 29 Left 924185191 1:241481318-241481340 CCCTAGCACAGTGCCTGCCACAG No data
Right 924185196 1:241481370-241481392 ATGAATGCTATTCTTAGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924185191 Original CRISPR CTGTGGCAGGCACTGTGCTA GGG (reversed) Intergenic
No off target data available for this crispr