ID: 924185232

View in Genome Browser
Species Human (GRCh38)
Location 1:241481827-241481849
Sequence GAGTAAATAGAGATGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924185229_924185232 -2 Left 924185229 1:241481806-241481828 CCAAACAACAATTTTACCTATGA No data
Right 924185232 1:241481827-241481849 GAGTAAATAGAGATGCTGCAGGG No data
924185227_924185232 30 Left 924185227 1:241481774-241481796 CCAGCAGAAGGATGATCTATTTG No data
Right 924185232 1:241481827-241481849 GAGTAAATAGAGATGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924185232 Original CRISPR GAGTAAATAGAGATGCTGCA GGG Intergenic
No off target data available for this crispr