ID: 924186177

View in Genome Browser
Species Human (GRCh38)
Location 1:241493822-241493844
Sequence GTCTCACTCATTCTGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924186176_924186177 5 Left 924186176 1:241493794-241493816 CCAGCTTTTGTTTTTATTTTCTG No data
Right 924186177 1:241493822-241493844 GTCTCACTCATTCTGTTGCCTGG No data
924186175_924186177 17 Left 924186175 1:241493782-241493804 CCACTGGGTCTACCAGCTTTTGT No data
Right 924186177 1:241493822-241493844 GTCTCACTCATTCTGTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924186177 Original CRISPR GTCTCACTCATTCTGTTGCC TGG Intergenic
No off target data available for this crispr