ID: 924192066

View in Genome Browser
Species Human (GRCh38)
Location 1:241564158-241564180
Sequence CCAAAAAAACAGCATAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 393}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924192066_924192069 8 Left 924192066 1:241564158-241564180 CCAAGACTATGCTGTTTTTTTGG 0: 1
1: 0
2: 2
3: 27
4: 393
Right 924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
924192066_924192068 4 Left 924192066 1:241564158-241564180 CCAAGACTATGCTGTTTTTTTGG 0: 1
1: 0
2: 2
3: 27
4: 393
Right 924192068 1:241564185-241564207 CTTACTCTGTAAGCTATACATGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924192066 Original CRISPR CCAAAAAAACAGCATAGTCT TGG (reversed) Intronic
901376348 1:8842371-8842393 CCAAAAAAATAAAAAAGTCTTGG - Intergenic
902175300 1:14645647-14645669 TCTAGAAAACACCATAGTCTTGG - Intronic
903629185 1:24753730-24753752 CCAAAAACACAGGAAAGTGTGGG - Intronic
903869505 1:26423339-26423361 CCAAACAAACAGAATAGGCCAGG - Intronic
905816064 1:40952032-40952054 CCAAAAAGACAGAACAGGCTGGG - Intergenic
905944836 1:41892822-41892844 CTCAAAAAACAGCAAAGGCTGGG + Intronic
906878942 1:49568231-49568253 TCTAGAAAACTGCATAGTCTTGG + Intronic
907406957 1:54259526-54259548 TCTAAAAAACAGCACAGTCATGG - Intronic
907432335 1:54420381-54420403 CCAATAAAACAGCATTTTATTGG - Intergenic
908903202 1:68979764-68979786 CCAGAAACACAGCCTAATCTTGG - Intergenic
909138585 1:71834091-71834113 CCAAATAAACTGCATTGTATTGG + Intronic
909575939 1:77176610-77176632 CCTAAAAGACACCATATTCTAGG - Intronic
910333379 1:86101286-86101308 CCTAGAAAACCCCATAGTCTTGG - Intronic
910543969 1:88393364-88393386 TCATAAAAACAGCATTGTATTGG + Intergenic
911703480 1:100983210-100983232 GCAAAAAAACAGCAGAGACAAGG + Intergenic
911930467 1:103896380-103896402 CCAAAACAGTTGCATAGTCTTGG + Intergenic
911979937 1:104554571-104554593 CTAAAAAAAACCCATAGTCTTGG + Intergenic
912317829 1:108682204-108682226 CCTAAAACACAGCATAATCTGGG - Intergenic
912790967 1:112650312-112650334 CCAAAAAAGCAGCATGGACAGGG - Intronic
912922863 1:113885910-113885932 AAAAAAAAAAAGCATAGGCTGGG + Intronic
913164702 1:116174282-116174304 ACAAAAGAACACCATTGTCTGGG + Intergenic
914739961 1:150456161-150456183 CCAAAAATAAAGCAAAGCCTGGG - Intronic
915110445 1:153561495-153561517 CCAGGAAAACAGCATACTCCTGG + Exonic
915262694 1:154689508-154689530 AAAAAAAAAAAGCATAATCTTGG + Intergenic
915315928 1:155029281-155029303 CCCAGAAGACAGCATAGTCTAGG + Exonic
916150248 1:161781189-161781211 CCAAAATATAAGCATATTCTGGG - Intronic
918202642 1:182281566-182281588 GCACAAAAAAAGCATAGGCTTGG - Intergenic
918509936 1:185300736-185300758 ACAAATAAACTGCTTAGTCTTGG + Intronic
919015399 1:192026965-192026987 CCTAGAAAACCCCATAGTCTTGG - Intergenic
919419027 1:197348373-197348395 CCAAGCACACACCATAGTCTAGG - Intronic
920117972 1:203634613-203634635 CTAAAACAACATCATAGACTGGG + Intronic
920157413 1:203965716-203965738 CCTAAAACACACCATATTCTAGG + Intergenic
922297961 1:224268634-224268656 CAAACAAAAAAGCTTAGTCTTGG - Intronic
923201759 1:231719124-231719146 CCAAAAAAACAAAAAAGACTTGG + Intronic
924192066 1:241564158-241564180 CCAAAAAAACAGCATAGTCTTGG - Intronic
924584297 1:245348384-245348406 ATAAAAAAACACCACAGTCTGGG + Intronic
1062959083 10:1559193-1559215 CCATAAAAGCAGCAGAGTCCTGG - Intronic
1064790648 10:18954478-18954500 GTAACAAAACAGCATAGACTGGG - Intergenic
1065663170 10:28027052-28027074 ATAAAAAAACACCATAGGCTGGG - Intergenic
1065809976 10:29432874-29432896 CCAAAAATAAATCATAGGCTGGG - Intergenic
1069399574 10:68028663-68028685 CAAAACAAAAAGCATATTCTTGG + Intronic
1069908331 10:71745307-71745329 CCAAGAAAGAAGCATATTCTGGG + Intronic
1071265762 10:83963418-83963440 GTAAAAAAACACCATAGACTGGG - Intergenic
1071322298 10:84475134-84475156 CCAATCAAACAGGAAAGTCTAGG - Intronic
1071477273 10:86035696-86035718 TGAACAAAACAGCATAGTCCAGG + Intronic
1071964605 10:90839521-90839543 CCAGAAAAACAGAATACTCAGGG + Intronic
1073398032 10:103234412-103234434 CCAAAAAGAAAGCAGGGTCTTGG + Intergenic
1073629743 10:105136477-105136499 CCACAGAACCAGCATTGTCTAGG + Intronic
1074037018 10:109749947-109749969 TCACCAAAACAGCATAGTATTGG - Intergenic
1077558043 11:3236024-3236046 CAAAAAAAACAAAATTGTCTAGG + Intergenic
1078070725 11:8107776-8107798 ACAAAACAACTGCATAATCTGGG - Intronic
1078446689 11:11410004-11410026 CCAAGACAACAGCATGGGCTGGG + Intronic
1079791278 11:24743067-24743089 TCACAAAAACAGCATAGTATTGG - Intronic
1080810113 11:35695608-35695630 CCTAAAAGACACCATATTCTAGG + Intronic
1081939921 11:46932095-46932117 AAAACAAAACTGCATAGTCTAGG + Intergenic
1083011494 11:59405174-59405196 CCTAAAAGACACCATATTCTAGG - Intergenic
1085760897 11:79240459-79240481 ACAATAAGACAGCATAGTCCAGG - Intronic
1086130000 11:83391292-83391314 CCAACAAAATACCATAGTCTAGG - Intergenic
1086547655 11:88016753-88016775 CAAAGAAAACACCATAGTTTTGG + Intergenic
1086611480 11:88761291-88761313 CCTAGAAAACCCCATAGTCTTGG + Intronic
1086835877 11:91621613-91621635 CTAAAAAATCAAGATAGTCTGGG - Intergenic
1087338432 11:96871721-96871743 CCAAGAAAAGAGCATAGTCTTGG - Intergenic
1087434967 11:98103453-98103475 CCAAAAATATATCATATTCTGGG + Intergenic
1087738800 11:101864185-101864207 CCAAAAAAAAAGCTCAATCTTGG + Intronic
1088452680 11:109998484-109998506 CCAAAAAAGCAGCCTGGGCTTGG - Intergenic
1090377139 11:126298616-126298638 CAAAAAAACCAGAATATTCTAGG - Intronic
1090439127 11:126711905-126711927 CCCTAAAAACAGGATATTCTAGG + Intronic
1092524802 12:9303116-9303138 CCAAAAAAAAAGAAGGGTCTTGG + Intergenic
1093251051 12:16805298-16805320 CAAAAAAGACAGCAAAGGCTCGG + Intergenic
1094182848 12:27610466-27610488 ACAGTAAAACACCATAGTCTGGG - Intronic
1094429369 12:30349968-30349990 CCAAATAGATAGCATAGTATCGG - Intergenic
1094733717 12:33208290-33208312 TCAAAAAAAAAGAATAGTATTGG - Intergenic
1095298522 12:40555151-40555173 CCCAGAGAACAGCATAGACTTGG - Intronic
1096694986 12:53343143-53343165 AAAAAAAAAAAACATAGTCTGGG + Intronic
1096888214 12:54739355-54739377 TCACAAAAACAGCATGGTATTGG - Intergenic
1097535045 12:60857938-60857960 GAAAAAAATCCGCATAGTCTTGG + Intergenic
1098802129 12:74974503-74974525 CCAAAATAATAGTATAGACTTGG + Intergenic
1099387431 12:82031622-82031644 GCAAATAAATAGCAAAGTCTGGG - Intergenic
1099543562 12:83946902-83946924 CAAACAAAACAGCACAGACTGGG - Intergenic
1099762926 12:86943268-86943290 ACAAAAATACCTCATAGTCTAGG + Intergenic
1102614002 12:114137271-114137293 CCAGAAAAACTGCCTATTCTGGG - Intergenic
1103023885 12:117558155-117558177 CCAAAAAAAGAGCACTGGCTGGG - Intronic
1103174625 12:118851905-118851927 CAAAATAAACAGCATATTCTTGG + Intergenic
1104071392 12:125349254-125349276 CCAAAAAGACAGCACAGAGTGGG - Intronic
1104118636 12:125775264-125775286 CCCAAGAAGCAGCACAGTCTAGG + Intergenic
1104456426 12:128917189-128917211 CCAACAAAACAGCATGATATTGG - Intronic
1105505307 13:21004810-21004832 CCTTAAAAACAGCAATGTCTTGG - Intronic
1106505016 13:30363690-30363712 CCAAAGACACAGCATGGTGTAGG - Intergenic
1106565900 13:30884459-30884481 CCAAAGAAACATCATTCTCTGGG + Intergenic
1106891117 13:34246617-34246639 AAAACAAAACAGCATACTCTAGG + Intergenic
1107628754 13:42320251-42320273 CAAAAAAAACACCACATTCTTGG - Exonic
1108913118 13:55579699-55579721 CTAAAAAAACCTCTTAGTCTAGG - Intergenic
1108993916 13:56700209-56700231 ACAAAAAACCAGCATAGTCTAGG - Intergenic
1109075282 13:57826047-57826069 CCAAAAAGACAGCCAAATCTAGG - Intergenic
1110059180 13:71019779-71019801 CCATAATAATAGCATAGTTTTGG - Intergenic
1110357659 13:74586643-74586665 CCAAGAAGACAGAATAGTCTGGG - Intergenic
1110460685 13:75741967-75741989 ACTAGAAAACTGCATAGTCTCGG + Intronic
1111205216 13:84999027-84999049 CCAAAAAGACAGAATAGTGCTGG - Intergenic
1111447270 13:88363827-88363849 CCAAATATACATTATAGTCTCGG - Intergenic
1111502351 13:89138321-89138343 CCAGAATATCAGCATTGTCTTGG - Intergenic
1111755064 13:92382504-92382526 CCATGAAAAGAGCATATTCTTGG + Intronic
1113484124 13:110642206-110642228 TCAAAAAAAAAGCATGGTCACGG + Intronic
1113732980 13:112655862-112655884 CTAAAAAAAAAGCAGAGTTTGGG - Intronic
1115179689 14:30608980-30609002 TCAAAAAAAAAGCACAGGCTTGG + Intronic
1115594339 14:34894630-34894652 CCAAAACAACAGCATAGGAATGG - Intergenic
1116185190 14:41591353-41591375 CAAAAAAACCAACATAGTTTTGG + Intergenic
1116381412 14:44273683-44273705 CCAAGAAAACAGCATACAGTAGG + Intergenic
1116753639 14:48918469-48918491 TAAACAAAACAGCATAGTATTGG + Intergenic
1117338379 14:54774025-54774047 GCAAGAAAACAGCAGAGTCAGGG - Intronic
1117637325 14:57757727-57757749 CAAAAACAACAGTATAGTCTGGG - Intronic
1117837382 14:59820884-59820906 TAAACAAAACAGCATAGTATTGG - Intronic
1118006127 14:61565462-61565484 AAAAAAAAATAGCATAGGCTGGG - Intronic
1118434420 14:65756434-65756456 CCAATAAAAAAGAACAGTCTTGG - Intergenic
1118681187 14:68243489-68243511 CAAAAAAATCAGCAAGGTCTAGG - Intronic
1120138735 14:80902387-80902409 TCAAAAAAATAACATAGTCAAGG + Intronic
1121388056 14:93548105-93548127 GCAAAAAAATACCATAGACTGGG + Intronic
1122299339 14:100723136-100723158 CCAAAAAAAAAACCTAGTCTAGG + Intergenic
1122949428 14:105033446-105033468 CCAAAACAAAACCATACTCTCGG + Intergenic
1124039790 15:26090680-26090702 CCCAAAAGACACCATATTCTAGG + Intergenic
1124228115 15:27914452-27914474 CCTAGAAAACCCCATAGTCTTGG + Intronic
1124584668 15:30993485-30993507 CCAAACATACAGCGTAGTCAAGG - Intergenic
1124862361 15:33454734-33454756 CCAAAAGAACAGCATATACAAGG + Intronic
1124992477 15:34689620-34689642 CCAACAAAATACCACAGTCTGGG - Intergenic
1125568918 15:40699436-40699458 ACAAAAAAACAGCACAGGCTGGG - Intronic
1126033863 15:44529201-44529223 CCAGAGGAACTGCATAGTCTTGG - Intergenic
1126865765 15:52935185-52935207 CCATAAAAACATCAGAGACTGGG + Intergenic
1127330664 15:57936375-57936397 CCTAGAAAACCCCATAGTCTTGG - Intergenic
1127828835 15:62731579-62731601 CCAAAAAAACAGAATAGCCCTGG - Intronic
1128049919 15:64655177-64655199 GAAAAAAAACAGAATAGTCCAGG + Intronic
1128320465 15:66690278-66690300 CCAACAAGACAGCATTGTTTGGG - Intergenic
1130783760 15:87073096-87073118 CAAAAAAAATAACATAGACTAGG + Intergenic
1131626699 15:94128050-94128072 CCAAAGAAGCAGCAGAGACTGGG - Intergenic
1132086661 15:98913952-98913974 ACAAAAAAACAGTGTAGCCTGGG + Intronic
1133481393 16:6174180-6174202 CCAAAAAACCAGCAAATTCGAGG - Intronic
1133952070 16:10404405-10404427 ACTAAAAATCAGCAGAGTCTGGG - Intronic
1134758712 16:16694011-16694033 ACAAACAAACAGCACAGGCTGGG + Intergenic
1134987364 16:18665160-18665182 ACAAACAAACAGCACAGGCTGGG - Intergenic
1137834087 16:51573987-51574009 CCAAAAAGACAGCATAAAATAGG + Intergenic
1137835489 16:51588505-51588527 ATAAAAAAACAGCATAGCATTGG - Intergenic
1138447726 16:57074994-57075016 AAAAAAAAAAAGCACAGTCTAGG - Intronic
1140203593 16:72914689-72914711 CCAAAAGAATAACATAGGCTAGG + Intronic
1140337228 16:74118974-74118996 AAAAAGAAACAGCATATTCTTGG + Intergenic
1141332193 16:83121055-83121077 ACAAAGAAACAGCATTGGCTGGG - Intronic
1143001203 17:3796366-3796388 CTCAGAAAACAGCATTGTCTTGG + Intronic
1143641953 17:8204105-8204127 ACAAAAAAACAGTTAAGTCTGGG - Intergenic
1146128958 17:30253420-30253442 CCACAAAAACCTCACAGTCTAGG + Intronic
1146751605 17:35386800-35386822 CCTAGAAAACCCCATAGTCTTGG - Intergenic
1148607430 17:48940788-48940810 TCAAAAAGACAGCATCCTCTGGG + Intronic
1149342058 17:55697645-55697667 CTAAAAAAAAAGCTTAGGCTGGG - Intergenic
1150940463 17:69687794-69687816 CCAAAAAAACAGCAACTTCAAGG - Intergenic
1151467496 17:74296896-74296918 CAAGAAAAACAGCAGAATCTTGG - Intronic
1151717528 17:75838803-75838825 TCAAAAAAGCAGCAAAGGCTGGG + Intronic
1154365509 18:13704941-13704963 CCTAAAAGACACCATATTCTAGG - Intronic
1155987761 18:32248498-32248520 CAAAAAAAACAACATGGTATTGG - Intronic
1157531462 18:48424371-48424393 CTAAAAATAGAGCATGGTCTTGG - Intergenic
1158460047 18:57638293-57638315 CAATCAAAACAGCATAGTATTGG - Intergenic
1158755981 18:60326114-60326136 CCAAAAAAACAGATAAGACTCGG + Intergenic
1158977216 18:62721088-62721110 CAACAAAAACAGCATATTTTTGG - Intronic
1159069861 18:63611644-63611666 TCAAAAAAACAAAAAAGTCTTGG + Intergenic
1159236903 18:65687250-65687272 CCAAAAATACAGAATTATCTGGG - Intergenic
1161995166 19:7707397-7707419 CCAAAAAAACAGCCTAGGTTTGG - Intergenic
1162010650 19:7812084-7812106 CTAATAAAACATCATAGGCTGGG - Intergenic
1162580330 19:11525914-11525936 TCAAAAAAAAAGCAAAATCTCGG + Intronic
1162867907 19:13562724-13562746 ATAAAAAAACAACCTAGTCTGGG - Intronic
1163109987 19:15153978-15154000 CCAAAAAGCCTGCATAGTTTGGG + Intergenic
1165678162 19:37746577-37746599 CCAAAAAAAAAACAAGGTCTGGG - Intronic
924980834 2:219600-219622 GTAACAAAACACCATAGTCTGGG - Intronic
925510962 2:4624920-4624942 CCAAAAAAAAACCTTAGTTTTGG - Intergenic
926183151 2:10664133-10664155 CCAAAAAAACAGAACAGGCCGGG + Intronic
927237750 2:20890684-20890706 CAAAATAAACAGCACAATCTTGG - Intergenic
930060721 2:47286273-47286295 CAAAAATACCACCATAGTCTGGG + Intergenic
930498412 2:52178597-52178619 CCTAAAAGACACCATATTCTAGG - Intergenic
930544377 2:52747883-52747905 CCAAATAAACAAAATTGTCTTGG - Intergenic
931489463 2:62727838-62727860 CCAAAATAACAGCCTTGTCTGGG - Intronic
931551964 2:63456477-63456499 CCAAAAACACAGCACAGGCTTGG - Intronic
932503485 2:72205673-72205695 CCATAAAAGCAGCAAAGTCCAGG + Intronic
933136000 2:78736531-78736553 CCAAAAAAAAAAAATAGTCTAGG - Intergenic
933425384 2:82104926-82104948 CCAAAAAAAGAGCAGACTATTGG + Intergenic
933428893 2:82149599-82149621 ACAACAAAACACCATAGGCTGGG - Intergenic
933433107 2:82210418-82210440 TCACCAAAACAGCATAGTATTGG - Intergenic
935056226 2:99570022-99570044 CCAGAATCACAGCATAGTTTTGG + Intronic
935531609 2:104239553-104239575 CAAAAAAAAAAGCAGAGTCAAGG + Intergenic
936474971 2:112831982-112832004 CCAAAGAAACAGGATTTTCTTGG + Intronic
936530119 2:113270416-113270438 ACACAAAAACAGCAAGGTCTGGG + Intronic
938006527 2:127791370-127791392 CCATAAAAATACCATAGACTGGG + Intronic
938166542 2:129033331-129033353 TCAATAAAACAGCATGGTATTGG + Intergenic
938234471 2:129693716-129693738 CCCAAAGAAAAGCATAGGCTCGG + Intergenic
939772960 2:146346654-146346676 CCAAAAAAAGAGTATCTTCTAGG + Intergenic
940125898 2:150323989-150324011 CCACCAAAACAGCATGGTTTTGG - Intergenic
940576938 2:155520438-155520460 GGAAAAAAACATTATAGTCTTGG - Intergenic
941599598 2:167525556-167525578 CAAAATAAACAGCAGAGTGTTGG - Intergenic
942888408 2:180957022-180957044 CTAAAAAAAAATCATAGACTGGG - Intergenic
943030216 2:182677153-182677175 TCAAGAAAACCCCATAGTCTTGG + Intergenic
943390551 2:187262088-187262110 CCAAGTAAACAGCTTAGACTAGG - Intergenic
943875724 2:193065207-193065229 CAACAAAAACAGCATAGTATTGG - Intergenic
944055873 2:195521234-195521256 CCAAAATAAAAGCCTTGTCTGGG + Intergenic
944178175 2:196857136-196857158 CCTAGAAAACCCCATAGTCTCGG + Intronic
944710612 2:202331957-202331979 CAAAATAAACAACATAGTATTGG - Intergenic
944920430 2:204407283-204407305 CCAGGCTAACAGCATAGTCTTGG + Intergenic
945395849 2:209316380-209316402 CCAAGAAAAGAACATATTCTGGG - Intergenic
946127518 2:217576767-217576789 CAAAATAAATAGCATAGTATTGG + Intronic
946473406 2:219984061-219984083 GTAAGAAAACAGCATATTCTTGG + Intergenic
946498684 2:220222452-220222474 CAAAAAAGACAGAATAGTCAAGG - Intergenic
947180317 2:227405564-227405586 CAAAAAAAACAGCATAATAGAGG + Intergenic
1169024886 20:2361969-2361991 ACAAAAAAACTGCAAACTCTGGG - Intergenic
1169570418 20:6899764-6899786 CCAAGAAAAGAGCATAATTTTGG - Intergenic
1170726499 20:18932531-18932553 TCACCAAAACAGCATAGTATTGG - Intergenic
1172586285 20:36087484-36087506 ACAAAAAAAAAGAATAGACTGGG - Intergenic
1173452444 20:43176998-43177020 CCAAAAATACAGGATATTATGGG - Intronic
1173978939 20:47208143-47208165 CCAAAAAAAGAGGAGAGTCCAGG + Intergenic
1173990366 20:47297800-47297822 CCAAAAAAACATCAGAGTTGGGG + Intronic
1174430718 20:50466618-50466640 ACAAAACAACAGCAAAGGCTGGG - Intergenic
1174515055 20:51085572-51085594 CAAGAAAAACAGCATATTCCTGG - Intergenic
1175733016 20:61366909-61366931 CCATAAAAACAGCATATTAACGG + Intronic
1176729207 21:10474042-10474064 CCTAAAATACAGTATAGTTTTGG + Intergenic
1176859224 21:13996725-13996747 ACAAAAAAAAATCAAAGTCTAGG - Intergenic
1177735778 21:25086837-25086859 ATAACAAAATAGCATAGTCTGGG - Intergenic
1178805823 21:35838216-35838238 CAAAAATAACAGCACATTCTGGG + Intronic
1179634947 21:42702998-42703020 CCAAAAAAATAGCTTCCTCTTGG - Intronic
1179722129 21:43321865-43321887 CCAATCAAACAGCAAAGTTTTGG - Intergenic
1180204358 21:46248394-46248416 CCAGAAAAACTGAACAGTCTAGG + Intronic
1182173040 22:28252858-28252880 CCAAAAGAACAGCATAAAATGGG + Intronic
1182505331 22:30778252-30778274 CCAAAGAAACAGCAATGGCTAGG - Intronic
1183012355 22:34957225-34957247 CCAAAATTACAGCATATTATAGG + Intergenic
1183350229 22:37330825-37330847 CCAAAGAAAGAGCATTTTCTTGG + Intergenic
1183995974 22:41632660-41632682 CCAAAAAAAAAGAATAAGCTGGG + Intronic
1184650921 22:45919145-45919167 CCAAGAAATCAGTACAGTCTGGG + Intergenic
1184920595 22:47603129-47603151 ATAAAAAAATAGCATAGACTGGG + Intergenic
950824422 3:15802261-15802283 CCAAACAAGGACCATAGTCTAGG + Intronic
950959440 3:17089515-17089537 CCAGAAAGGCAGCATACTCTTGG + Intronic
951282359 3:20767707-20767729 TAAACAAAACAGCATAGTGTTGG - Intergenic
951366901 3:21794449-21794471 ACAACAAAACACCATAGACTGGG + Intronic
951572051 3:24074451-24074473 TCAAAAAAACAGCATGGTACTGG - Intergenic
951925934 3:27908788-27908810 CCAAAATAATAGCATAGTTCAGG + Intergenic
952059770 3:29493612-29493634 CCAAAAAAACAGAACAGATTTGG - Intronic
952135849 3:30418168-30418190 CAAAAAAGACAGCACAGACTGGG + Intergenic
952215876 3:31277859-31277881 ATAAAAAAACACCACAGTCTGGG + Intergenic
952935008 3:38390507-38390529 CCAAAAAAATATAATAGGCTGGG - Intronic
954474058 3:50726761-50726783 CCACAACAACAGCAAACTCTGGG + Intronic
954968515 3:54632361-54632383 GGAAAAAAACAGAATACTCTAGG - Intronic
955127476 3:56127735-56127757 AAAAAAAACCAGCATAGTATTGG + Intronic
955130433 3:56160852-56160874 TAAACAAAACAGCATAGTATTGG - Intronic
955509280 3:59663251-59663273 CCACATAAAAAGCATTGTCTCGG + Intergenic
955964594 3:64375269-64375291 GCAAAAAGACAGCATAGTACTGG + Intronic
956290791 3:67657525-67657547 CTAAAACAACAGCTAAGTCTTGG - Intergenic
956298479 3:67741043-67741065 CAAACAAAACAGCATAGTATTGG - Intergenic
956367218 3:68517461-68517483 CCAAACAAACTGGGTAGTCTTGG - Intronic
956584408 3:70849171-70849193 TCAAAAAAACAGCATGGTGGCGG + Intergenic
957387023 3:79509199-79509221 TGAAAAAAACAACATATTCTGGG + Intronic
957750761 3:84412220-84412242 CCTAAAAGACAACATATTCTAGG - Intergenic
958099487 3:88990327-88990349 CCAAAAAATTATCACAGTCTGGG + Intergenic
958446790 3:94225487-94225509 CAGAAAAAACTGCATAGGCTGGG - Intergenic
960833573 3:121879790-121879812 CTAAGAAAACAGCATGGTATTGG - Intronic
961337828 3:126194006-126194028 CCTAAAAGACACCATATTCTAGG + Intronic
961952800 3:130768157-130768179 TAAAAAAAACAGCATAGTACTGG + Intergenic
961969559 3:130946154-130946176 TCATAAAAACAGCTTAATCTTGG - Intronic
962245984 3:133793760-133793782 CCTAAAAGACACCATATTCTAGG - Intronic
964462439 3:156949535-156949557 CCAAAAGAACAGCATGGTACTGG - Intronic
965605586 3:170495175-170495197 GCAAAAAAACAGCAAAATCTTGG - Intronic
966571173 3:181445156-181445178 ACACAAACACAGCATAGGCTTGG - Intergenic
967134289 3:186500106-186500128 ACTAAAAAACCCCATAGTCTCGG - Intergenic
967453878 3:189658408-189658430 CCAAAAATACAGCATAGAAAGGG + Intronic
970124389 4:12792794-12792816 CCAAAAAACCAACAGAGTCCAGG - Intergenic
970402499 4:15731294-15731316 CCAAAAATGCATCATACTCTTGG + Intronic
970782486 4:19755059-19755081 CCAAAAAAACATCATACTCCAGG + Intergenic
970946754 4:21702094-21702116 ACAACAAAATACCATAGTCTGGG + Intronic
972152572 4:36112258-36112280 CCCTAAAAAAAGTATAGTCTAGG + Intronic
972810649 4:42582278-42582300 CTAACAAAACACCATAGACTAGG - Intronic
973035413 4:45399536-45399558 CCTTAAAGACACCATAGTCTAGG + Intergenic
973257653 4:48129328-48129350 TCAAAAAAACAGAACAGTCAAGG - Intronic
975748545 4:77498369-77498391 ACAAAAGAACAGAATAGGCTGGG - Intergenic
976220214 4:82750924-82750946 CCAAGAAACCAGCCTAGCCTGGG - Intronic
978895268 4:113879151-113879173 CCAAAATAAAAGCTTTGTCTGGG + Intergenic
979170230 4:117592558-117592580 CCTAAAAAACACCATTTTCTAGG + Intergenic
979941125 4:126764169-126764191 CAAAAAAAGCCGCATAGTCAAGG + Intergenic
980017860 4:127673900-127673922 ACAAAAAAACAGAAAACTCTAGG - Intronic
981233773 4:142390883-142390905 CCTAAAAGACACCATATTCTAGG - Intronic
981680541 4:147392393-147392415 ACAACAAATCACCATAGTCTGGG - Intergenic
983616363 4:169709935-169709957 CCAAAAAAAAAAAATTGTCTGGG + Intronic
984127921 4:175835133-175835155 CCAATAAGACAGCATAGCCCAGG + Intronic
984366590 4:178806591-178806613 ACAAAGAGACAGCATAGACTGGG - Intergenic
984972733 4:185205158-185205180 CCTAAAAGACAGCATTGGCTGGG + Intronic
985151496 4:186951795-186951817 CAAACAAAACAGCATGGTATTGG - Intergenic
986299055 5:6463920-6463942 GCAAAATAACAGCACAGGCTGGG - Intronic
986540053 5:8835401-8835423 GCAAGAAAACAGCATAGACTGGG - Intergenic
986904074 5:12472065-12472087 CCTAGAAAACCCCATAGTCTTGG + Intergenic
988196266 5:28009942-28009964 CTAAAAAAACACCACAGACTGGG - Intergenic
988568158 5:32337582-32337604 CCTAAAAGACACCATATTCTGGG + Intergenic
990811942 5:59736328-59736350 CTAAAATAACAGAATATTCTGGG + Intronic
991038098 5:62148560-62148582 ACAACAAAATAGCATAGACTGGG + Intergenic
991177037 5:63701084-63701106 CAAACAAAACAGCATGGTATAGG + Intergenic
991699793 5:69306630-69306652 GAAAAAAAATAGCATAGGCTGGG - Intronic
991989108 5:72320102-72320124 CCCAAAAAACAGAATAATCAGGG + Intronic
994022033 5:95038320-95038342 CAAAATAAATAGCATAGTATTGG + Intronic
994790687 5:104222789-104222811 GTAAAAAAACAACATAGGCTGGG - Intergenic
995325431 5:110884714-110884736 CCTAAAAGACATCATATTCTAGG - Intergenic
995703870 5:114964918-114964940 CCTAGAAAACCCCATAGTCTCGG - Intergenic
995901344 5:117071011-117071033 CAACCAAAACAGCATAGTATTGG - Intergenic
997605391 5:135172313-135172335 CCACCAAAACAGCATAATATTGG - Intronic
998300441 5:141013594-141013616 CAAAAAAATCAACATAGTCTTGG + Intergenic
998768952 5:145520156-145520178 TCAACAAAATAACATAGTCTTGG - Intronic
1000506324 5:162124447-162124469 CTAGAAAAACAGCATAGAATAGG + Intronic
1000811821 5:165872666-165872688 CCAGAAGAAGAGCAAAGTCTTGG + Intergenic
1001674450 5:173500383-173500405 CCAAAGAAACAGCAAAGGGTTGG + Intergenic
1002924310 6:1595896-1595918 CCAAAAGAACAGCTTGGTTTAGG + Intergenic
1007728273 6:43930004-43930026 CCAAAATAACAGCAGAGACATGG + Intergenic
1007837515 6:44685145-44685167 CCAAAAAAAAAGAATAATGTCGG + Intergenic
1008434665 6:51461541-51461563 CCAGAAACACAGCATACTGTAGG + Intergenic
1010763041 6:79746475-79746497 CCAAGAAAACCCCATAGTCAAGG - Intergenic
1011690162 6:89859547-89859569 CCAAAAAAAAAAAAAAGTCTGGG - Intronic
1012350474 6:98244117-98244139 ACAAAAAAACAGAAAAGTATTGG + Intergenic
1012490294 6:99775890-99775912 TCTAGAAAACTGCATAGTCTTGG - Intergenic
1014163066 6:118192459-118192481 CCTAAAAGACACCATATTCTAGG + Intronic
1014222291 6:118809843-118809865 AAAAAAAAACAACATAGACTGGG - Intergenic
1015164595 6:130189449-130189471 CCAAACAAATACCATAGACTTGG - Intronic
1015199702 6:130565583-130565605 CCCAATAAGCAGCCTAGTCTGGG + Intergenic
1015378231 6:132534966-132534988 CCAAAAAAACTGTATATTATCGG - Intergenic
1016565137 6:145443631-145443653 CTAAAAAAACCCCATAGTCTCGG - Intergenic
1018605116 6:165588836-165588858 TCACAAAAACTGCATAGTGTAGG - Intronic
1018716951 6:166540723-166540745 CCACAAAAGCTGCACAGTCTCGG - Intronic
1020377960 7:7509127-7509149 CAAAAAAAACAAAATAGGCTGGG - Intronic
1021100324 7:16581339-16581361 TCACAAAAACAGCATCTTCTGGG - Exonic
1022619686 7:31970372-31970394 CCAACAATACAGAAAAGTCTCGG + Intronic
1027008370 7:74718613-74718635 TCAAAAAAATCCCATAGTCTTGG - Intronic
1027628273 7:80571118-80571140 CAAAAGAAACAGAATAGGCTGGG - Intronic
1028176589 7:87667387-87667409 GAAAAAAAAAAACATAGTCTTGG - Intronic
1028201511 7:87967513-87967535 TTAAAAAAACAGTATAGGCTGGG + Intronic
1028543088 7:91966711-91966733 CAAACAAATCAGCATGGTCTTGG - Intronic
1029156754 7:98522634-98522656 ATAACAAAATAGCATAGTCTGGG + Intergenic
1030144351 7:106338388-106338410 CCTAAAAGACACCATATTCTAGG - Intergenic
1031183018 7:118440880-118440902 CCTAGAAAACCACATAGTCTTGG + Intergenic
1031246518 7:119320337-119320359 CAAAAAAAACAGCCGAGTTTTGG + Intergenic
1031294772 7:119987405-119987427 CCTACACAACACCATAGTCTTGG + Intergenic
1031683888 7:124709047-124709069 CCAAAGACAGAGCATACTCTGGG - Intergenic
1032112027 7:129084277-129084299 AAAAAAAAAAAGCATAGTCAAGG - Intergenic
1034600382 7:152247567-152247589 CCTAAAATACAGTATAGTTTTGG - Intronic
1037253376 8:16923097-16923119 CAACCAAAACAGCATAGTATTGG - Intergenic
1039703815 8:39987502-39987524 CAAAAAAAAGAGCATGGACTTGG + Intronic
1039940844 8:42089525-42089547 TAACAAAAACAGCATAGACTGGG - Intergenic
1040089531 8:43383030-43383052 CCCAAAAGACACCATATTCTGGG + Intergenic
1040402546 8:47066626-47066648 CCTAAAAGACACCATATTCTAGG - Intergenic
1040742467 8:50594840-50594862 CAAGAAAAACAGCTGAGTCTTGG + Intronic
1040803833 8:51372093-51372115 CCAAAAAAAAAACATTGTCGTGG + Intronic
1040986573 8:53300667-53300689 CAAGAAAAACCCCATAGTCTTGG - Intergenic
1041607893 8:59805632-59805654 CCAACAAAACATCATATCCTGGG + Intergenic
1041734659 8:61097063-61097085 TTAAAAACACAGCATAGGCTGGG + Intronic
1042346312 8:67731654-67731676 CCACAGAAACAGAATAGTCCTGG - Intronic
1042709156 8:71696004-71696026 CCAAAAAAACATCATTTTTTGGG - Intergenic
1043231960 8:77814447-77814469 CAAACAAAACAGCATGGTGTTGG + Intergenic
1043826068 8:84929857-84929879 CAAAAAAAGCACCATACTCTAGG + Intergenic
1043826969 8:84940948-84940970 CCTAAAAGACACCATATTCTAGG - Intergenic
1044642552 8:94399210-94399232 CCTAAAAAACTCCAAAGTCTGGG + Intronic
1045564683 8:103301053-103301075 CCAGAAAAACAGAATAGTAAAGG + Intronic
1045581908 8:103490981-103491003 CCTAGAAAACCCCATAGTCTTGG + Intergenic
1045832375 8:106478619-106478641 CCAGAAAAACAGAATATTTTAGG + Intronic
1045922718 8:107550222-107550244 CTAAAAAAACACAATAGTCTTGG - Intergenic
1045929963 8:107610563-107610585 ACAACAAAACACCATAGACTAGG - Intergenic
1046100305 8:109606467-109606489 TCTAAAAACCAGCATAGTATGGG - Intronic
1046734580 8:117763430-117763452 CATAAAAAACAGCACAGACTGGG - Intergenic
1046899609 8:119509762-119509784 CCCAAAGAACAATATAGTCTCGG + Intergenic
1047232042 8:123005808-123005830 CCAAAAAACCAACAAAGACTAGG + Intergenic
1048536205 8:135297642-135297664 CCTGAAAAACAAAATAGTCTTGG + Intergenic
1048632874 8:136263105-136263127 CCTAACAAACATCATAGCCTAGG + Intergenic
1048698592 8:137057692-137057714 CCAAAAGAACAACAGAGTATTGG - Intergenic
1049127631 8:140806248-140806270 CTTCAAAAACAGCATAGTATAGG - Intronic
1050401479 9:5260401-5260423 CCTAAAAGACATCATATTCTAGG + Intergenic
1050870254 9:10558862-10558884 CCAGAAAAACAACACAGTCTTGG + Intronic
1050893534 9:10855751-10855773 GCTAGAAAACAGCATAGACTTGG + Intergenic
1052929335 9:34043460-34043482 TGAAAAATACAGCATAGTTTGGG - Intronic
1053457965 9:38245749-38245771 TTAAAATAACAGCATAGGCTGGG - Intergenic
1054924645 9:70577103-70577125 ACAAATAAACAGCATACTTTGGG - Intronic
1055550657 9:77429439-77429461 CCACAAAAACAGAATAGGCTCGG - Intronic
1055836237 9:80446372-80446394 CCAAATAAACAGCAGAGGCCAGG - Intergenic
1056054922 9:82811574-82811596 TAACAAAAACAGCATAGTATTGG + Intergenic
1056087440 9:83165233-83165255 CCAAAAACAGATCATATTCTGGG + Intergenic
1057705825 9:97394284-97394306 GCAACAAAACACCATAGACTGGG - Intergenic
1058275267 9:103033287-103033309 ACAAAAAACCAACATAGTATTGG + Intergenic
1059475022 9:114539591-114539613 TCAAATAAACAGCAAAATCTTGG - Intergenic
1061224120 9:129270755-129270777 ACAAAAAAACAGAAGAGTGTAGG + Intergenic
1061351984 9:130072600-130072622 CAATAAAAACAGCATCGGCTGGG - Intronic
1185835260 X:3339731-3339753 TCTAAAAATCAGCAGAGTCTGGG + Intronic
1185927771 X:4166250-4166272 CCAGAAAAACAACACAGTCTGGG - Intergenic
1186438532 X:9564973-9564995 CTAAAAAAAAATCATAGGCTGGG + Intronic
1186612756 X:11154236-11154258 CCAAGAAAATAGCAAAGACTTGG - Intronic
1187308294 X:18116766-18116788 CAAAAACAACAGCCTTGTCTAGG + Intergenic
1187441502 X:19324721-19324743 GCAAAAAAACAACATAGACAAGG + Intergenic
1188487117 X:30694053-30694075 TAAAATAAACAGCATAGTTTTGG + Intronic
1188708067 X:33359829-33359851 CCCAAAAAACAGAATGGGCTGGG + Intergenic
1188817841 X:34737411-34737433 CCCAAAAAACAGCATAGTACTGG - Intergenic
1188843978 X:35050904-35050926 TAACAAAAACAGCATAGACTGGG - Intergenic
1189743995 X:44151072-44151094 CCAGAAAACCATCAAAGTCTAGG + Intronic
1189852747 X:45193418-45193440 AGAAAAAAACAACACAGTCTAGG - Intronic
1191638010 X:63398847-63398869 CCTAAAACACACCATATTCTAGG + Intergenic
1191789528 X:64954613-64954635 CCTAAAAGACACCATATTCTAGG - Intronic
1191950750 X:66589434-66589456 TCAAAAAAACAGCATGGTACTGG - Intergenic
1191967134 X:66771437-66771459 GTAAAAAAACAGCATAGTACTGG - Intergenic
1192009783 X:67256616-67256638 CATATAAAACAGCATAGTCCTGG + Intergenic
1192792046 X:74392279-74392301 AGAAAAAAACCCCATAGTCTTGG + Intergenic
1192839682 X:74841378-74841400 TCAAGAAAACCCCATAGTCTTGG - Intronic
1192869289 X:75171047-75171069 CCACAAAAAGATCATTGTCTAGG - Intergenic
1192938764 X:75890523-75890545 ACAAAAATACATCATATTCTGGG + Intergenic
1192959179 X:76109170-76109192 CCAAAACACCAGCATAGAATGGG + Intergenic
1193030620 X:76894303-76894325 TCAAGAAAACCCCATAGTCTTGG + Intergenic
1193230539 X:79040160-79040182 TCTAAAAAACCTCATAGTCTTGG - Intergenic
1194138301 X:90175592-90175614 CCTAAAAGACATCATATTCTAGG + Intergenic
1194468810 X:94266986-94267008 TCTAAAAAACTGCATAGTCTTGG + Intergenic
1195690504 X:107620501-107620523 GCAAAAAAACAGCCTAATATAGG - Intergenic
1195812283 X:108847772-108847794 TCACAAAAACAGCATGGTATTGG + Intergenic
1196219272 X:113092663-113092685 TCACAAAAACAGCATAGTACTGG + Intergenic
1196420689 X:115517656-115517678 TCAAAATAACAATATAGTCTTGG - Intergenic
1197515162 X:127418733-127418755 TCACAAAAACAGCATGGTATTGG - Intergenic
1197615412 X:128685077-128685099 CTATAAAAGCAGCATATTCTTGG + Intergenic
1198022042 X:132668561-132668583 CCAAAAAAACAGCTTCATGTAGG + Intronic
1198259796 X:134955662-134955684 AAAAAAAAACAGCATACTGTGGG - Intergenic
1198755732 X:139980586-139980608 TCAAAAAAAAAGGATACTCTGGG - Intergenic
1199199420 X:145069811-145069833 GCAGAATAACAGCATAGACTAGG - Intergenic
1199913324 X:152311794-152311816 CCTAGAAAACACCATAGTTTTGG + Intronic
1200484101 Y:3745832-3745854 CCTAAAAGACATCATATTCTAGG + Intergenic
1200866672 Y:8051450-8051472 CCAAAAAGATATCATAGTCAGGG - Intergenic
1201331520 Y:12827318-12827340 CCAAAAACAGTGCATAGTATAGG - Intronic
1201509344 Y:14740900-14740922 CAAAAAAAAAAGTATAGTTTGGG - Intronic
1201766446 Y:17577300-17577322 CCAAAAAAACCCCACAGCCTGGG + Intergenic
1201835106 Y:18328689-18328711 CCAAAAAAACCCCACAGCCTGGG - Intergenic