ID: 924192069

View in Genome Browser
Species Human (GRCh38)
Location 1:241564189-241564211
Sequence CTCTGTAAGCTATACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924192066_924192069 8 Left 924192066 1:241564158-241564180 CCAAGACTATGCTGTTTTTTTGG 0: 1
1: 0
2: 2
3: 27
4: 393
Right 924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924192069 Original CRISPR CTCTGTAAGCTATACATGGA AGG Intronic
900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG + Intronic
900880658 1:5378911-5378933 CTCAGTAAGCTAAAAATGGAAGG + Intergenic
902789337 1:18755659-18755681 TTCTGCAAGCTATACAAGCATGG - Intergenic
907762259 1:57372863-57372885 TTCTTTAAGGTAGACATGGAAGG - Intronic
913391970 1:118324123-118324145 CTCTGTTAGATACACCTGGAGGG - Intergenic
915617370 1:157049521-157049543 CTCTGTAAGCTATAGAGTGCTGG + Intergenic
916191532 1:162183642-162183664 CTCTGTAACATAAAAATGGAAGG - Intronic
917918244 1:179726263-179726285 CTCTGCAAAATATACAGGGAAGG + Intergenic
918028106 1:180773736-180773758 CTCTTAAAGCAAAACATGGAGGG - Intronic
918476448 1:184930098-184930120 GTCTGTAAGAGACACATGGAAGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063497290 10:6521744-6521766 CTCTGCAAGAGATAGATGGAGGG - Intronic
1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG + Intronic
1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG + Intergenic
1070588983 10:77788248-77788270 CTCTTTAAACTATACATTTATGG + Intergenic
1070945094 10:80384165-80384187 CTCTGTAAGCTCCAGAGGGATGG - Intergenic
1071203784 10:83251527-83251549 CTCTGCAAGCTGTACAAGCATGG + Intergenic
1074296628 10:112195260-112195282 ATCTGTAAGGAATATATGGAAGG - Intronic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1080044480 11:27794872-27794894 TTCTGCAGGCTATACAAGGATGG + Intergenic
1083799382 11:65037772-65037794 CTCCCTGAGCAATACATGGAGGG + Intronic
1084982665 11:72839553-72839575 CTCTGCAAGGTATACCTGGCAGG + Intronic
1085362417 11:75902360-75902382 TACTGTAAACTATACATGCAAGG - Intronic
1086005884 11:82035220-82035242 TTCTGTAAGCTATACAAGAATGG + Intergenic
1086414016 11:86570756-86570778 CTGTGTACGTCATACATGGAAGG - Intronic
1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG + Intronic
1088030707 11:105245986-105246008 CTATCTAAACTATACATGGTTGG - Intergenic
1089896129 11:121931976-121931998 GACTGTAAGCTATTCAGGGAAGG - Intergenic
1090521356 11:127482995-127483017 TTCTGCAGGCTATACAAGGATGG + Intergenic
1093213271 12:16332817-16332839 CTCTGTAAGCAGGACATGGGTGG - Intergenic
1093550518 12:20404804-20404826 CTCTGTAACCTACACATGTGTGG - Intronic
1093994505 12:25627254-25627276 CTCTGAAAGGCATCCATGGAGGG + Intronic
1094169955 12:27480821-27480843 TTCTGTAAGCTGTACAGGCATGG - Intronic
1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG + Intergenic
1099544184 12:83955891-83955913 CTCTGCAGGCTATACAAGCATGG + Intergenic
1099561301 12:84177749-84177771 CTCTATAAACTATACATATAGGG + Intergenic
1101434865 12:104655788-104655810 CTCTGTCACCTATACCTGAATGG - Intronic
1106703544 13:32255899-32255921 CTCTGGAAGTTATACAAGGGAGG + Intronic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1112953353 13:105030023-105030045 CTCTCTAAGCCGTAAATGGAGGG - Intergenic
1116300163 14:43169676-43169698 CTATGTAAGCAATACATTTATGG + Intergenic
1116521124 14:45848367-45848389 TTCTGTAGGCTATACAAGCATGG + Intergenic
1117778672 14:59208984-59209006 TTCTGCAGGCTGTACATGGATGG - Intronic
1118692448 14:68352953-68352975 CTCTATAGGCTAAACATGGGAGG - Intronic
1120129294 14:80786192-80786214 CTCTCTAAGATTTACATGGAAGG + Intronic
1121370284 14:93351540-93351562 ACCTGTAAGCTAAACAAGGAAGG - Intronic
1122511575 14:102272727-102272749 CTCAGCAAGCTATTCATGAAAGG + Intronic
1125925930 15:43563156-43563178 CTCTGTAAACCATAAATTGAAGG - Intronic
1125939074 15:43662707-43662729 CTCTGTAAACCATAAATTGAAGG - Intronic
1127088995 15:55448083-55448105 CTCAGTAAGCTAGATATTGATGG - Intronic
1130141978 15:81235273-81235295 TTCTGCAAGCTATACAAGCATGG + Intronic
1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG + Intronic
1134794443 16:17022153-17022175 TTCTGTATGATATACATGTACGG - Intergenic
1137864651 16:51880675-51880697 CTCTGTAAAATGTAGATGGATGG - Intergenic
1140780551 16:78292829-78292851 CTTTGTAAGGTATTCAAGGATGG + Intronic
1144028695 17:11301094-11301116 CTCTGACAGCTAGACGTGGAAGG - Intronic
1144401247 17:14904618-14904640 CTCTGTACGCAAGAGATGGAGGG + Intergenic
1144872695 17:18380731-18380753 CTCTGTGAGCTAGACCTGGTTGG - Intronic
1153215671 18:2818403-2818425 CTCAGAAAACTAGACATGGAAGG + Intergenic
1155079646 18:22395995-22396017 GTATGGAAGCTATAAATGGAAGG - Intergenic
1160072454 18:75640542-75640564 CTCTGTAAGGTTTAAGTGGAAGG - Intergenic
1160727994 19:626448-626470 ATATTTAAGCTATACATGGCTGG - Intronic
1161747365 19:6069264-6069286 CTATGTTATCTATACATTGATGG - Intronic
1162451802 19:10759538-10759560 CTCAGGAAGGTATGCATGGAAGG - Intronic
1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG + Intergenic
925179754 2:1809462-1809484 CTCTGAAAGTTATACAATGAAGG - Intronic
925616169 2:5746398-5746420 CTCTTTAAGCTATTCTTGGAAGG + Intergenic
925753223 2:7108721-7108743 CTAGGTCAGCTATTCATGGATGG - Intergenic
928475298 2:31620154-31620176 CTCAGTAAACTATATATTGAAGG + Intergenic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
932975383 2:76594005-76594027 GTCTGTAATCTGTACATGAAAGG - Intergenic
933610902 2:84434116-84434138 TTCTGCAGGCTATACATGCATGG - Intronic
934591720 2:95557933-95557955 CTCTGTATCCTACACAAGGAGGG - Intergenic
942347330 2:175017086-175017108 TTCTGCAAGCTATACAAGCATGG - Intergenic
943275251 2:185858784-185858806 TTCTGCAGGCTATACATGCATGG + Intergenic
946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG + Exonic
946669083 2:222083120-222083142 TTCTGGAAGCCATACATGAAAGG + Intergenic
947012824 2:225584281-225584303 TTCTGTAAGTTATATATTGATGG - Intronic
947197371 2:227582438-227582460 TTCTGTAGGCTATACAAGCATGG - Intergenic
948257467 2:236578477-236578499 CTCTGAAAGCCTTCCATGGAGGG - Intronic
1172982154 20:38951530-38951552 ATCTTTAAGTTTTACATGGACGG + Exonic
1177966830 21:27738141-27738163 TTCTGCAGGCTATACATGCATGG + Intergenic
1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG + Intergenic
1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG + Intergenic
1184899625 22:47436861-47436883 CTCTGCAAGCTGTACAGGCATGG - Intergenic
949810020 3:7997145-7997167 CTCTGGTACCTATACATGGGAGG - Intergenic
951170245 3:19533524-19533546 GTCTGTAAGCTCTCCCTGGAGGG - Exonic
952110387 3:30116678-30116700 CATTGTAAGATATATATGGAAGG + Intergenic
952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG + Intergenic
955785488 3:62533524-62533546 CTCTGTAAGGTAGACAGAGAAGG + Intronic
957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG + Intergenic
963927542 3:150966914-150966936 CTCTGTGATCTATACAACGAGGG - Intronic
964731408 3:159870392-159870414 CTTTGTAAGTTATACCTGGGAGG - Intronic
964831826 3:160892203-160892225 TTCTGTAGGCTATACAGGCATGG + Intronic
966296199 3:178426822-178426844 CTCTGTAAGCATTTCATGCAGGG + Intronic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
967441030 3:189509237-189509259 CTCTGTAAGTTATGCTGGGATGG + Intergenic
968780925 4:2580779-2580801 TTCTGTAGGCTATACAAGCATGG - Intronic
969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG + Intronic
972993027 4:44845980-44846002 AACTGTAACCAATACATGGAAGG + Intergenic
976013098 4:80516396-80516418 TTCTGTGGGCTATACAAGGATGG + Intronic
980274458 4:130631581-130631603 CTGTGTGAGGTATACATGTAAGG - Intergenic
981689128 4:147486961-147486983 CTCTGTAGGCTGTACATGCATGG + Intronic
982386114 4:154804126-154804148 TTCTGTAAGCTTTACAAGCATGG - Intronic
985514310 5:332091-332113 CTCTGGAAACTATACATACATGG - Intronic
987883387 5:23779688-23779710 CTCTACAAGGTGTACATGGAAGG + Intergenic
988519776 5:31935158-31935180 CTTTGTTAGCTATACTTGTAAGG - Intronic
990550491 5:56872297-56872319 ATCTGGAAGGTATACATGAAGGG + Intronic
995887358 5:116910958-116910980 ATGTATAAGCAATACATGGAAGG + Intergenic
1008113286 6:47517242-47517264 TTCTGCAAGCTATACAAGCATGG - Intronic
1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG + Intronic
1012977670 6:105797370-105797392 ACCTGTGAGCTAGACATGGAAGG - Intergenic
1017373171 6:153736437-153736459 CTCTGTAGCCTATTCATGGAGGG + Intergenic
1018373485 6:163189559-163189581 ATCTGTAAGCTAAAAATTGATGG - Intronic
1020666138 7:11046474-11046496 CTCTGTAAACTATTCCTAGAAGG - Intronic
1021993532 7:26158628-26158650 CTCTGTAACCTACTAATGGAGGG - Intronic
1022293400 7:29025251-29025273 TTCTGTAGGCTATACAAGTATGG + Intronic
1022899324 7:34787217-34787239 CTCTGTAATATAAACATGCAAGG - Intronic
1024933722 7:54690947-54690969 CTTTGGAAACTAAACATGGATGG + Intergenic
1027704853 7:81517128-81517150 TTTTTTAAGCTATACTTGGAAGG - Intergenic
1027855391 7:83504770-83504792 CTCTGGAAGCTATGAAGGGAGGG + Intronic
1027949738 7:84799664-84799686 TTCTGTAGGCTATACAAGCATGG - Intergenic
1028431606 7:90753455-90753477 CTCAGTAAGCTAGGCATTGAAGG + Intronic
1033440524 7:141374017-141374039 CTCTTTAAGGAATAAATGGAAGG - Intronic
1035838557 8:2786057-2786079 CTATGGAAACTACACATGGACGG + Intergenic
1036495565 8:9267225-9267247 CTCCTTAAGCTGTACTTGGAAGG + Intergenic
1039844276 8:41314935-41314957 CACTGTACGATGTACATGGAAGG - Intergenic
1052508279 9:29382238-29382260 GACTGTGAGCTGTACATGGACGG + Intergenic
1056478352 9:86975136-86975158 CTTTCCAAGCTAAACATGGAGGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059538897 9:115111333-115111355 CTGTGTAACCTAATCATGGAAGG - Intronic
1060493103 9:124099345-124099367 GTGTGTAGGCTATACTTGGAGGG - Intergenic
1060929957 9:127483091-127483113 CTCTGTTGGCCATGCATGGAGGG + Intronic
1192183465 X:68930546-68930568 CTCAGTAAGCTGTACACAGAGGG + Intergenic
1197299946 X:124766099-124766121 GTCTGTGAGATAGACATGGAAGG + Intronic