ID: 924193409

View in Genome Browser
Species Human (GRCh38)
Location 1:241579382-241579404
Sequence TGCCCAGCACAACTCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924193409_924193419 26 Left 924193409 1:241579382-241579404 CCAGGTCAGAGTTGTGCTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 924193419 1:241579431-241579453 GGGGCCAGGAGACAGTTTTCTGG No data
924193409_924193413 5 Left 924193409 1:241579382-241579404 CCAGGTCAGAGTTGTGCTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 924193413 1:241579410-241579432 ATGCAAGCAGCATTCCCTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 173
924193409_924193412 4 Left 924193409 1:241579382-241579404 CCAGGTCAGAGTTGTGCTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 924193412 1:241579409-241579431 CATGCAAGCAGCATTCCCTGTGG 0: 1
1: 0
2: 3
3: 17
4: 212
924193409_924193415 7 Left 924193409 1:241579382-241579404 CCAGGTCAGAGTTGTGCTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 924193415 1:241579412-241579434 GCAAGCAGCATTCCCTGTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 165
924193409_924193416 12 Left 924193409 1:241579382-241579404 CCAGGTCAGAGTTGTGCTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 924193416 1:241579417-241579439 CAGCATTCCCTGTGGGGGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 244
924193409_924193414 6 Left 924193409 1:241579382-241579404 CCAGGTCAGAGTTGTGCTGGGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 924193414 1:241579411-241579433 TGCAAGCAGCATTCCCTGTGGGG 0: 1
1: 0
2: 3
3: 27
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924193409 Original CRISPR TGCCCAGCACAACTCTGACC TGG (reversed) Intronic
901644191 1:10707815-10707837 TGGCCAGCACATCTGGGACCTGG + Intronic
902293136 1:15447873-15447895 AGCCCAGCACCACCCAGACCCGG + Intronic
902627440 1:17684745-17684767 TGCACAGCCCACCCCTGACCAGG - Intronic
902709383 1:18228117-18228139 TGCCCAGGACAACTCAGGACTGG - Intronic
903211700 1:21822617-21822639 GGCCCACCCCAACTCTTACCAGG - Exonic
904025311 1:27499116-27499138 TGCCCTGCACAAGCCTGGCCAGG - Intergenic
904492693 1:30870554-30870576 TGACCAGCCCAAATCTGCCCTGG - Intronic
905823962 1:41015509-41015531 GGCCCAGCCCACCTCTGTCCAGG - Intergenic
907839702 1:58144791-58144813 TGCATGGCACAACTCTGACCTGG - Intronic
909887923 1:80965602-80965624 ATCTCAGCACAACTTTGACCAGG + Intergenic
912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG + Intronic
914862959 1:151401352-151401374 TTCCCAGCACATCCCTCACCCGG - Exonic
914941214 1:152024459-152024481 TTCCCAACACATCTCTCACCAGG + Intergenic
920183996 1:204149389-204149411 TGCCCACTCCAAGTCTGACCTGG - Intronic
923433827 1:233949896-233949918 TGCCCAGGGCATCTCTGCCCAGG - Intronic
924193409 1:241579382-241579404 TGCCCAGCACAACTCTGACCTGG - Intronic
1067295470 10:44973046-44973068 AGCCCAGCACAGCTTGGACCAGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1070780410 10:79134315-79134337 TTCCCAGCAAAACAGTGACCAGG + Intronic
1071986520 10:91056684-91056706 AGCCCAGGACAAGTGTGACCAGG - Intergenic
1075796536 10:125123932-125123954 TGCCCAGCACAGAGCTGCCCCGG - Intronic
1075995477 10:126873266-126873288 CACCCTGCACACCTCTGACCAGG - Intergenic
1076784290 10:132741977-132741999 TGTCCCACACAGCTCTGACCTGG - Intronic
1078058139 11:8024215-8024237 TGCTCAGCACGACTCTAGCCCGG + Intronic
1078060843 11:8041908-8041930 TGCCCAGCAGTCCTGTGACCTGG + Intronic
1079031068 11:16986988-16987010 TGCCCAGCCCAACCCAGCCCAGG + Intronic
1079080973 11:17413515-17413537 TGCTCGGGCCAACTCTGACCAGG - Intronic
1083654967 11:64225180-64225202 TGCCCAGCATAGCGCTGGCCCGG + Intronic
1085349924 11:75791803-75791825 TGCCCAGCACAGCCCTGCACTGG - Intronic
1087171202 11:95051381-95051403 TGCCAAGCACAATTCTGGCCTGG + Intergenic
1088469422 11:110177316-110177338 TGCACTGCACAACTTTGAGCAGG + Intronic
1088740868 11:112765804-112765826 TGCCCGGGACACCTCTGCCCCGG + Intergenic
1092046151 12:5432941-5432963 GCCCCAGCACCACTCTGGCCCGG + Intronic
1093585666 12:20832669-20832691 TGCCAAGCACACTTCTGACTTGG + Intronic
1095121790 12:38427586-38427608 TGCCCAGCAGAACTCAAAACAGG - Intergenic
1098248103 12:68540856-68540878 TGCCATGCACCACTCTGACTAGG - Intergenic
1101639891 12:106580497-106580519 AGCCCAGCACAGCTCAGAGCCGG - Intronic
1103004482 12:117409866-117409888 TGCTCAGGACATCTCTGTCCTGG - Intronic
1105805168 13:23948179-23948201 AGCTCTGCACAACTCAGACCTGG - Intergenic
1107284223 13:38772210-38772232 TACCCAGCACAAATATGAGCTGG - Intronic
1111432233 13:88159492-88159514 TGCACAGCAGCACTCTGAGCAGG - Intergenic
1113792627 13:113037289-113037311 TGTCTAGCTCAACTCTGCCCTGG - Intronic
1113875643 13:113592977-113592999 TGCACAGCACACCTGTCACCTGG - Intronic
1113875689 13:113593216-113593238 TGCACAGCACACCTGTCACCTGG - Intronic
1113875803 13:113593768-113593790 TGCACAGCACACCTGTCACCTGG - Intronic
1113875918 13:113594321-113594343 TGCACAGCACACCTGTCACCTGG - Intronic
1118288683 14:64501729-64501751 TTCCCAGCACAGCCCTGGCCAGG + Intronic
1118723859 14:68612910-68612932 TTCCCAGCAGTGCTCTGACCAGG - Intronic
1120682593 14:87498597-87498619 TGGCAAGCACAACTTTGAGCTGG + Intergenic
1122370182 14:101225304-101225326 TGCCCAGCAAGCCTCTCACCAGG - Intergenic
1123109601 14:105859698-105859720 AGCCCAGCTCAGCTCTGCCCAGG + Intergenic
1124170119 15:27365525-27365547 TGCACAGCCCAGCTCTGACCAGG - Intronic
1124653089 15:31487125-31487147 TGCTCAGCTCCAGTCTGACCAGG - Intronic
1125032391 15:35085701-35085723 TCCCCTGCCCAACACTGACCAGG - Intergenic
1125502836 15:40250156-40250178 TGCCCAGCTCAGCCCTGCCCAGG - Intronic
1125726054 15:41868628-41868650 TGCCCAGCCCAGCCCTCACCCGG - Intronic
1125968171 15:43890941-43890963 TCCCCAGCAGAACGCTGACTAGG + Intronic
1126262989 15:46716123-46716145 TGCTCAGCACTACTCTCAGCTGG - Intergenic
1128126815 15:65198967-65198989 TGCCCTGCACAAGTCTTAACAGG + Exonic
1128568863 15:68718895-68718917 TTCACAGCACATCTCTCACCTGG - Intronic
1138615967 16:58167206-58167228 TGGACAGGACAACTATGACCAGG - Exonic
1139890780 16:70252050-70252072 TACCCTGCACAACTGGGACCGGG - Intergenic
1141703536 16:85653035-85653057 TGCCCAGGCCTACCCTGACCTGG - Intronic
1142186455 16:88697158-88697180 TGCCCAGCCCGACCCTGCCCCGG - Exonic
1143747001 17:9002426-9002448 TCCCCAGCACAACACTCCCCCGG - Intergenic
1144421261 17:15101306-15101328 TGACCAGTGCAACTCTTACCAGG - Intergenic
1144725950 17:17502894-17502916 TGCCCAGAACAACTCTGTAGGGG + Intergenic
1145960685 17:28884996-28885018 TGGCCAGAACAACTCTTTCCAGG - Intronic
1148477705 17:47940246-47940268 TGCCCAGTCCAATTCTGAGCTGG - Intergenic
1149544816 17:57495578-57495600 TCCCCTGAACATCTCTGACCTGG + Intronic
1151758604 17:76088407-76088429 GGCCCAGCACCACAGTGACCTGG - Intronic
1151837004 17:76588318-76588340 TTCCCAGCAAAACTCTGACCTGG + Intergenic
1151889395 17:76943298-76943320 GGCCCAGCACAAATCTCAGCTGG - Intronic
1154061982 18:11070817-11070839 TGCCCAGCACTTCTGTGACCAGG - Intronic
1154073733 18:11178964-11178986 TGCCCAGCACAACCCACAGCTGG + Intergenic
1154356334 18:13625217-13625239 TGCCCAGCACTTCTCACACCAGG - Intronic
1154414733 18:14170869-14170891 TGCCCAGCCCAACACTGCCCAGG - Intergenic
1157522939 18:48357657-48357679 TGCCCCACCCAACCCTGACCAGG + Intronic
1157530332 18:48414851-48414873 AGCCTTGCACAGCTCTGACCAGG - Intergenic
1158842124 18:61398899-61398921 TGGCCAGCACAAGTCTGCCAGGG + Intronic
1160160362 18:76465989-76466011 TGCCCAGCAGAAGTTTGAACTGG - Intronic
1161038849 19:2099455-2099477 TGGCCAGCTCAGCTCTGTCCGGG - Exonic
1162042446 19:7979012-7979034 GGCCCAGCACCACACTGGCCAGG + Intronic
1163770253 19:19186783-19186805 TGTCCACCACGCCTCTGACCTGG + Intronic
1164121859 19:22272962-22272984 TGCCTTGCACCACTCTGACAAGG + Intergenic
1166575912 19:43837519-43837541 TGCTCAGCACAAGGCTGGCCAGG - Intronic
925851643 2:8087824-8087846 TGCCTAGGTCAACTCTGCCCAGG + Intergenic
926165432 2:10520136-10520158 TGCCCAGGGCGGCTCTGACCAGG - Intergenic
927920577 2:26969497-26969519 TGTCCAGCACTGCTCTGCCCGGG - Intergenic
928711711 2:34014478-34014500 TGCCTAGCAAAACTCTCAGCGGG + Intergenic
929791278 2:45024814-45024836 TGCCCAGGACCTCTCTGAGCTGG - Intergenic
930035713 2:47083897-47083919 TACCCAGAACAACTGTCACCTGG + Intronic
930865647 2:56119921-56119943 TGCCCAGGAAAACTAAGACCTGG - Intergenic
931065171 2:58578147-58578169 TGCCAAGCACACCTCTGCCTCGG - Intergenic
932300567 2:70664029-70664051 TGCCTAGAAAAACTCTGAGCTGG - Intronic
933803733 2:85983068-85983090 TCCCCAGCACCCCTCTGACCGGG + Intergenic
935810290 2:106790996-106791018 TCCACAGGACAAGTCTGACCAGG - Intergenic
938240748 2:129740882-129740904 AGCCCAGCACACCTTTCACCTGG - Intergenic
938294232 2:130167439-130167461 TGACCAGCTCAACTCTCACCTGG + Exonic
938462419 2:131506439-131506461 TGACCAGCTCAACTCTCACCTGG - Intergenic
938958414 2:136319637-136319659 TGCCCAGCACACAGCAGACCCGG - Intergenic
941107851 2:161379932-161379954 TGCCCAGGAGAAGTATGACCTGG + Intronic
942244384 2:173993511-173993533 TGCTCTGCACAACTCTGAGTGGG + Intergenic
943818624 2:192289770-192289792 AGCCCAACTGAACTCTGACCTGG + Intergenic
944274804 2:197823649-197823671 TGACCATCACAACTCCAACCTGG - Intronic
946025066 2:216666719-216666741 TGTCAAGCACATCTCTCACCTGG + Intergenic
946161671 2:217839466-217839488 TGTCCAGCACAGCACTGTCCTGG - Intronic
946572019 2:221034870-221034892 TGGCCAGCCCAGCTCTGTCCAGG + Intergenic
948012432 2:234660367-234660389 AGCCCAGCACAGCCCTCACCTGG + Intergenic
948263445 2:236621191-236621213 TGCCCAGCACAGCCGTGAGCCGG + Intergenic
1174328017 20:49795030-49795052 TGCCCAGCACAGCACAGACGTGG - Intergenic
1175264886 20:57696446-57696468 TGCCCAGCACACCGCAGAGCAGG - Intronic
1175547137 20:59785631-59785653 TGCCCAGCTCCACGCTGACAGGG + Intronic
1176063778 20:63183688-63183710 TGCCCCACACACCTCAGACCAGG + Intergenic
1176250280 20:64117322-64117344 TGCCCCGCACAGCTTTGCCCAGG - Intergenic
1176250298 20:64117371-64117393 TGCCCCGCACAGCTTTGCCCAGG - Intergenic
1176250370 20:64117621-64117643 TGCCCCGCACAGCTTTGCCCAGG - Intergenic
1176250791 20:64118980-64119002 TGCCCCGCACAGCTTTGCCCAGG - Intergenic
1176858287 21:13987385-13987407 TGCCCAGCCCAACACTGCCCAGG + Intergenic
1179185804 21:39084459-39084481 TGCTCAGCACAAGTGTCACCTGG + Intergenic
1179495869 21:41771034-41771056 GTCCCAGCACCACCCTGACCAGG + Intergenic
1179541324 21:42085047-42085069 GGCCCAGCTCACCTCTGAGCAGG + Intronic
1181318280 22:21985273-21985295 ACCCCAGCTCCACTCTGACCAGG + Intergenic
1183068161 22:35377985-35378007 GGACCAGAACAACTCTGGCCTGG + Intergenic
1185212776 22:49581051-49581073 TGCCCAGCACAACTTATGCCTGG - Intronic
1185233285 22:49695341-49695363 TGCCCAGCAAAGCTCTCAGCTGG - Intergenic
949157513 3:847276-847298 TGCCATGCACCACTCTGACGAGG - Intergenic
950290394 3:11779440-11779462 TGACCAACACACCTCTTACCAGG + Intergenic
954554684 3:51508630-51508652 TCCCCAGCCCACCTCTCACCTGG + Intergenic
957021845 3:75136752-75136774 TGCCGTGCACCACTCTGACAAGG - Intergenic
958874199 3:99597222-99597244 AGCCCAGCACATCTCTGGCTGGG + Intergenic
961372628 3:126440803-126440825 TTCCCAGCCCACCTCTGCCCAGG + Intronic
961651487 3:128418705-128418727 TGCCCAGCACCCCTGTGGCCGGG + Intergenic
963954208 3:151235204-151235226 TGCCTGGCAGAACTCTGAGCAGG + Intronic
969307715 4:6335377-6335399 TGCCCAGCACACCCCTCTCCAGG - Intronic
969646736 4:8434548-8434570 TGCCATGCACCACTCTGACGAGG - Intronic
969885467 4:10211417-10211439 TGCCTACCACAATTCTGACTTGG + Intergenic
971019111 4:22516224-22516246 TGCCGAGCCCGACTCCGACCCGG + Intergenic
977972072 4:103224254-103224276 TGCCATGCACCACTCTGACAAGG - Intergenic
985031698 4:185796527-185796549 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031712 4:185796577-185796599 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031726 4:185796627-185796649 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031740 4:185796677-185796699 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031754 4:185796727-185796749 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031768 4:185796777-185796799 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031782 4:185796827-185796849 TGCCCAGCCCCACCGTGACCAGG - Intronic
985031807 4:185796927-185796949 TGCCCAGCCCTACCGTGACCAGG - Intronic
985031820 4:185796980-185797002 TGCCCAGCCCCACTGTGACCAGG - Intronic
987707717 5:21476698-21476720 TCCTCAGCAAAATTCTGACCAGG - Intergenic
990336142 5:54774635-54774657 TGGCCAGCTCTGCTCTGACCAGG + Intergenic
991653507 5:68880565-68880587 TGCTCAGCAGACCTCTGATCTGG + Intergenic
992371945 5:76152630-76152652 TTCCCACCACACCTCTGCCCTGG - Intronic
997469379 5:134108416-134108438 TGCTCACCACAGCTCTAACCAGG - Intergenic
999431055 5:151525749-151525771 AGCCTAGCACAGCTCTCACCTGG + Exonic
1002211791 5:177603863-177603885 TGCCCTGAGCAGCTCTGACCAGG + Intronic
1006626846 6:35403722-35403744 TTCTCACCACAACCCTGACCCGG - Intronic
1008374539 6:50777189-50777211 TGCCCAGCACAAGCCAGACCAGG + Intergenic
1014657543 6:124127169-124127191 TGCACAGCTCAAGTCTTACCTGG - Intronic
1018841909 6:167523509-167523531 AGCCCAGCCCACCTCTGTCCTGG - Intergenic
1019179943 6:170180155-170180177 TCCCCAGCACATCTCTGGCGCGG - Intergenic
1024346781 7:48321818-48321840 TGCCCAGCCCACATCTTACCTGG - Intronic
1024946542 7:54813561-54813583 TGCACAGGACAGCTCTGAACTGG + Intergenic
1031809483 7:126347826-126347848 TGCCCAGAACTGCTTTGACCAGG - Intergenic
1031920033 7:127593687-127593709 GGCCCAGCACCTCTGTGACCCGG - Exonic
1034872548 7:154696786-154696808 CCCACAGCACAGCTCTGACCAGG - Intronic
1035703068 8:1651942-1651964 TGCCCAGCCCGGCTCTGACGAGG - Intronic
1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG + Intergenic
1036656492 8:10680636-10680658 GGCCCAGACCACCTCTGACCTGG + Intronic
1039403431 8:37292751-37292773 TGACCAGCTCCACTCTGCCCAGG + Intergenic
1048581528 8:135733049-135733071 TCCCCAGGACAAGCCTGACCTGG - Intergenic
1053343304 9:37358355-37358377 TGCCCAACACAACTATGCCAAGG - Intergenic
1053862385 9:42400294-42400316 TGCCTCTCTCAACTCTGACCTGG + Intergenic
1055487192 9:76767746-76767768 TGCCCAGCACAAGTCTATCCAGG + Intronic
1056578391 9:87872695-87872717 TGCCCAGCACAGCCATCACCAGG - Intergenic
1056731048 9:89167085-89167107 TGGCCAGCACACCCCTGCCCTGG + Intronic
1059579213 9:115525438-115525460 TGCCCACCACCACCCTGACTTGG - Intergenic
1061635020 9:131902267-131902289 CGCCCAGCACGACTCTGTCAGGG - Intronic
1061799776 9:133107423-133107445 TGCCCAGCACACAAGTGACCCGG + Intronic
1062213894 9:135378732-135378754 TGCCCAGCCCAGGTCTGACGTGG + Intergenic
1062419149 9:136471037-136471059 GGCCCAGGAGGACTCTGACCTGG + Intronic
1185519849 X:730102-730124 TGCCCAGCTGACCTCTGACTGGG - Intergenic
1186905916 X:14110380-14110402 TGCAGAGCACAAGTCTGATCTGG + Intergenic
1188129480 X:26413476-26413498 TCCCCAGAAGAACTCTGACAAGG - Intergenic
1190632459 X:52401122-52401144 GGCTCAGCACAACTCTGGCCAGG + Intergenic
1190653560 X:52591282-52591304 GGCTCAGCACAACTCTGGCCAGG - Intergenic
1190654340 X:52597987-52598009 GGCTCAGCACAACTCCGGCCAGG + Intergenic
1190999830 X:55648156-55648178 GGCCCGGTACAATTCTGACCAGG + Intergenic
1194336803 X:92658197-92658219 TGCCCAGCAGAACACTTGCCTGG + Intergenic
1195674392 X:107496823-107496845 TGCCCAGCTCAGCTCTCCCCAGG - Intergenic
1200645236 Y:5774937-5774959 TGCCCAGCAGAACACTTGCCTGG + Intergenic