ID: 924194418

View in Genome Browser
Species Human (GRCh38)
Location 1:241590868-241590890
Sequence CTGCCCCCGAGGAGAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924194418 Original CRISPR CTGCCCCCGAGGAGAACAGG AGG Intronic