ID: 924204502

View in Genome Browser
Species Human (GRCh38)
Location 1:241697937-241697959
Sequence TTCATGCCTTCTCTTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924204499_924204502 20 Left 924204499 1:241697894-241697916 CCCAGTATCTTACTGTTGGTTCT 0: 1
1: 0
2: 2
3: 9
4: 199
Right 924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 153
924204500_924204502 19 Left 924204500 1:241697895-241697917 CCAGTATCTTACTGTTGGTTCTT 0: 1
1: 0
2: 2
3: 12
4: 249
Right 924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924204502 Original CRISPR TTCATGCCTTCTCTTAATGG TGG Intronic
900770995 1:4544245-4544267 TGCATGTCTTCTCTTCTTGGAGG - Intergenic
901914604 1:12488489-12488511 TTCATCTCTTCTCTTAAAAGAGG + Intronic
903911828 1:26732728-26732750 TTCTTGCCCTCCCTTACTGGAGG - Exonic
904131521 1:28279226-28279248 GTCATACCTTCTCTGAGTGGCGG - Exonic
905385743 1:37602724-37602746 TTCATGCCTTTTCTTGACGTAGG - Intergenic
909750076 1:79148405-79148427 TGCATGCCTTCTCATTATAGAGG - Intergenic
911451937 1:98073908-98073930 TTCCTTCCTTCTCATTATGGTGG - Intergenic
917088382 1:171327310-171327332 TTAATGCCTTCTCTTCTGGGAGG + Intronic
917539044 1:175895811-175895833 TCCATGCTTTGTCTTACTGGTGG - Intergenic
920927365 1:210354992-210355014 TTCATCACTTCCCTTAATGAAGG + Intronic
921424710 1:214988163-214988185 TATATTCCTTCTCTTAATGTGGG + Intergenic
924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG + Intronic
924658374 1:245993916-245993938 TTAATGTCTTCTTTTTATGGTGG - Intronic
1065492998 10:26301571-26301593 TTTTTCCTTTCTCTTAATGGAGG + Exonic
1065839305 10:29687744-29687766 TTTATACCTTTTCTTAAAGGGGG - Intronic
1071003567 10:80857982-80858004 TCCATGTCTTCTCTTACTGGAGG + Intergenic
1076035181 10:127194668-127194690 TCCATGCCTTATCTCAGTGGGGG - Intronic
1078918830 11:15807794-15807816 TTCATGCCAGCTCTTAAAGCTGG - Intergenic
1085232677 11:74986394-74986416 TACATTCCTTCTATTAATGAAGG + Intergenic
1089066186 11:115663835-115663857 TTCATGAGTTGTCTTAATGGGGG + Intergenic
1092077133 12:5683315-5683337 TTCATCCCTGCTTTTGATGGTGG - Intronic
1096768676 12:53917275-53917297 TTCATGTCTTCTATTAATTCTGG + Intergenic
1098495068 12:71124380-71124402 TTCATGCCACCTCTCAGTGGTGG - Intergenic
1099477584 12:83126027-83126049 TGAATACCTTCTCTTAATGATGG - Intronic
1099536166 12:83847698-83847720 TTCTTTCCTTCTGTTAATAGGGG + Intergenic
1104998527 12:132674114-132674136 ATCTTGCCTTCTATTAAAGGAGG - Intronic
1105809879 13:23985591-23985613 TTCAAGCCTTATCTTCCTGGAGG + Intronic
1105929769 13:25041555-25041577 TTCAAGCCTTATCTTCCTGGAGG - Intergenic
1107096673 13:36545057-36545079 TGCATGGCTTCTCTTACTGAAGG - Intergenic
1110473549 13:75887558-75887580 ATAATGCCTTCTCTTGCTGGTGG + Intergenic
1111084559 13:83357932-83357954 CTCATCCCTTCTCTTGGTGGGGG - Intergenic
1113559452 13:111266575-111266597 TTCATGCCTTCTTATAATTAAGG + Intronic
1114230587 14:20778175-20778197 TTCATGTATTCTCTTCATAGGGG - Intergenic
1115321898 14:32090154-32090176 TTCCTGCCTTCTGTCACTGGAGG - Intronic
1116923115 14:50602459-50602481 TTCATGCCTTCTAATTATGTAGG + Intronic
1117610949 14:57482961-57482983 TTCATGCACTCTCTGCATGGAGG - Intronic
1118142998 14:63105656-63105678 TTGCTGCCTTCTCTCAATGCTGG - Intergenic
1121885111 14:97535667-97535689 GTCCTGCCTGCTCTTTATGGGGG + Intergenic
1125910139 15:43430125-43430147 TTGTTTCCTTCCCTTAATGGTGG - Intronic
1126268699 15:46786810-46786832 TTCATGGCTTCTCTTTAAGCAGG + Intergenic
1126556219 15:49990477-49990499 TTCATGTCTTCTCTTCAGAGGGG - Intronic
1127254993 15:57282469-57282491 TTCTTCCCTTCTCTTAAGGCAGG - Exonic
1127944306 15:63734785-63734807 TCCATCCGTTCTCGTAATGGAGG + Exonic
1128881357 15:71246010-71246032 TTCATGTCCTCTCTTGATGCTGG - Intronic
1129122185 15:73406059-73406081 TTCATTCATTCTCTTATTGATGG + Intergenic
1133563833 16:6974201-6974223 TCCATGTCTTTGCTTAATGGGGG + Intronic
1134124052 16:11604225-11604247 TTCATGCCTGCTCTAAAATGTGG + Intronic
1134423433 16:14115903-14115925 GTCATGGCTTGTCCTAATGGTGG - Intronic
1136013529 16:27380581-27380603 TGCCTGCCTTCTCTTGTTGGGGG + Intergenic
1143888201 17:10082264-10082286 TTCTTTCCTTCTCTTCCTGGAGG - Intronic
1146397401 17:32479781-32479803 TCCCTCCCTTCTCTTATTGGAGG + Intronic
1147591180 17:41684349-41684371 TGCATGCCTGCTGTTAATGCTGG - Intergenic
1148580835 17:48742619-48742641 CTCATTCCTTCTCTCACTGGAGG + Intergenic
1148589372 17:48804289-48804311 TTCATAGCTTCCCTTAATGGGGG - Intronic
1149242398 17:54665298-54665320 TTTATGCCACCTCTAAATGGTGG + Intergenic
1151307361 17:73271858-73271880 TTCATGCCTTCTCTAGAGAGTGG - Intergenic
1153612536 18:6900779-6900801 TTGATGCCTTTTCCTAATTGGGG - Intronic
1155747934 18:29384343-29384365 TTCATCCATTCTCTTAAAGTGGG + Intergenic
1158300157 18:56043071-56043093 TTAATGCCTGCTCTTAAGAGAGG + Intergenic
1158401242 18:57123211-57123233 TTCCAGCCTTCTTTTCATGGAGG + Intergenic
1158982806 18:62781324-62781346 TTCATGTCTTGCCTTAATGTGGG + Intronic
1165135789 19:33667605-33667627 TTAATGCATTCGCTCAATGGAGG - Intronic
1167686305 19:50958916-50958938 TTCCTGTATTCTCTTAGTGGTGG + Exonic
924971597 2:132956-132978 TCCATGCCTTCTCATTTTGGTGG + Intergenic
926044637 2:9701035-9701057 TTTATGCCTTCTCCTATTGATGG + Intergenic
927612887 2:24559618-24559640 TTCCTGCCTTCTCTTTCTTGTGG + Intronic
927910478 2:26894550-26894572 TTGAGGCCTTCTGTTAATGATGG + Intronic
931803848 2:65785696-65785718 GTCATGTCTGCTCTCAATGGTGG + Intergenic
942538746 2:176993614-176993636 TTTATCCCTTCTCTTAATTAGGG + Intergenic
942625558 2:177896560-177896582 TTCCTGCCTTTGTTTAATGGGGG + Intronic
943334821 2:186600656-186600678 CTGATTCCTGCTCTTAATGGAGG - Intronic
945967175 2:216200843-216200865 TTCATCCATTCTCCTAATGATGG + Intronic
1170154091 20:13253713-13253735 TTCATGTGTTCTCAAAATGGGGG - Intronic
1173169699 20:40713921-40713943 TTGCTGCCTTCTCTAAATGGAGG + Intergenic
1173622935 20:44450391-44450413 TTCATGCCTGCTCTTCCTGCTGG + Intergenic
1173721040 20:45258448-45258470 TTTATGCCTTCTCTGAATACTGG + Intergenic
1174652022 20:52134756-52134778 TTTATGGCTTCTCTTTATGTTGG - Intronic
1177911326 21:27036488-27036510 TTATTGCCTTCTCTTAATACAGG - Intergenic
1178024902 21:28455254-28455276 TTCAAGCCTGCTCTTTATGATGG + Intergenic
951744020 3:25956676-25956698 TTCATTCCTTCTGTCCATGGAGG - Intergenic
952490390 3:33865505-33865527 GTCATCCCTTCTCCAAATGGAGG + Intronic
956716188 3:72082080-72082102 TTCATGCCTTCTCCAAGTTGTGG - Intergenic
958041847 3:88235330-88235352 TTCATGACTGCTATTAGTGGTGG + Intergenic
959491638 3:106996868-106996890 TTCATGGATTCTTTTAATAGCGG + Intergenic
960082007 3:113551998-113552020 GTCATGGCTTATCTTCATGGTGG - Intronic
961473380 3:127132396-127132418 CTCCTGCCTTCTCTCCATGGTGG + Intergenic
962448703 3:135493102-135493124 TCCATGCTTTCTCTAAATGGAGG + Intergenic
964181845 3:153897416-153897438 TTCAGGTCTGCCCTTAATGGAGG - Intergenic
965601926 3:170463233-170463255 TCCTTGCTTTCTCTTAATGGAGG + Exonic
966762096 3:183427860-183427882 TTCCTGCGTTTTATTAATGGCGG - Intronic
969459392 4:7320816-7320838 TTCATGCATTCACTTAAAGAAGG + Intronic
970495902 4:16625749-16625771 TCCATGGCTTCTCTTAGTGATGG + Intronic
971149114 4:24012339-24012361 TACAAGTCTTCTCCTAATGGTGG + Intergenic
974924867 4:68285043-68285065 TAAACGCCTTCTCCTAATGGAGG - Intergenic
975765847 4:77666841-77666863 TTCATTCTTTCTCTTAAAAGTGG - Intergenic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
976833572 4:89344298-89344320 TTCTTGCCTTCTCCTAATTTCGG + Intergenic
980656858 4:135799819-135799841 TTCTTGCTTTCTCTAAAAGGCGG - Intergenic
981048914 4:140292067-140292089 TTCCTGCCTTCTTTTGATTGTGG + Intronic
982561467 4:156933064-156933086 CCCATGCCTTCTCTGAATCGGGG + Intronic
983878512 4:172905365-172905387 TTCAGGTCTTCTCTTAATAAAGG - Intronic
987469040 5:18308068-18308090 TTCATGCCTTCTCTCAAAGCTGG + Intergenic
987790775 5:22564790-22564812 TTCATCTCTTCTTTTAATGATGG + Intronic
989094950 5:37773189-37773211 TGCCTTCCTTCTCTTAATGAGGG + Intergenic
990736185 5:58865614-58865636 TTCATTCCTTCTACTAATTGTGG - Intergenic
992358465 5:76010288-76010310 TTCATGCCTGCTCGTCAGGGTGG + Intergenic
992383224 5:76259035-76259057 TTCCTGTCTTCTCCTATTGGGGG + Intronic
992610649 5:78505424-78505446 TCCATTCCTTCTCTTTCTGGAGG - Intronic
992812664 5:80405646-80405668 TTTAACCATTCTCTTAATGGTGG + Intergenic
995062356 5:107824591-107824613 CTCATGCCATCTGTAAATGGGGG + Intergenic
995619683 5:114010817-114010839 TTCTTGTCTTCCCTTAATGGGGG - Intergenic
996356661 5:122603081-122603103 TTCATGTCTTCTATCAATGTTGG - Intergenic
997369348 5:133348078-133348100 CTCATGTCTTATTTTAATGGTGG - Intronic
1004334054 6:14747887-14747909 TTTATTCCTTCTCTTTATGTAGG - Intergenic
1004880575 6:20003331-20003353 TCCATGCCTTTTCTTAATTCGGG - Intergenic
1011801467 6:91020761-91020783 TTTAAGCCTTCTCTCAATAGAGG + Intergenic
1012200205 6:96396684-96396706 TTTATTCCTTGTCTTAATGATGG - Intergenic
1012306913 6:97669805-97669827 TTCTTGCCTTATTTTAATGTAGG - Intergenic
1015072231 6:129108514-129108536 TACAAGCCTTCTCTAAATGTGGG - Intronic
1015145605 6:129982393-129982415 TTCTTGCCTTCTTTGAGTGGTGG + Intergenic
1015145625 6:129982744-129982766 TTCTTGCCTTCTTTGAGTGGTGG - Intergenic
1015397246 6:132748604-132748626 TTAATGTCTTCTCTGAATTGTGG - Intronic
1018389778 6:163333286-163333308 TTCATTCCTTCTCCTATTGACGG - Intergenic
1018429052 6:163709368-163709390 TTCGTGCCCTTTCTTCATGGTGG - Intergenic
1019107518 6:169681140-169681162 TTTATGCATTCTCCTATTGGTGG - Intronic
1022338430 7:29445303-29445325 CTCATGTCTCCTGTTAATGGAGG + Intronic
1022627353 7:32051577-32051599 TTTATGCCTTTTCTTACAGGAGG - Intronic
1024692774 7:51820691-51820713 TTCATTCCTTCTCTGATTGCTGG + Intergenic
1024787295 7:52922768-52922790 TCCTTGCCTTCTTTTAATGAGGG - Intergenic
1028505867 7:91569499-91569521 TTTATCCCTTCTCCTAATTGGGG + Intergenic
1028719655 7:94014272-94014294 TTCATACCTTCTCACACTGGTGG + Intergenic
1031049552 7:116931306-116931328 TTCATGCCATCTCTTTACAGAGG - Intergenic
1032784532 7:135190067-135190089 TTCTTGCTTTCTCTTAGTTGTGG - Intronic
1034308386 7:150065461-150065483 TACATGCCATCTCTTCATGAGGG - Intergenic
1034504518 7:151476819-151476841 TTCATGTCTCCTCTTATCGGGGG - Intronic
1034798467 7:154035214-154035236 TACATGCCATCTCTTCATGAGGG + Intronic
1036151516 8:6303375-6303397 CACATGCATTCTATTAATGGGGG + Intergenic
1043771020 8:84200764-84200786 TGCATTCCTACTTTTAATGGGGG + Intronic
1045128552 8:99122298-99122320 TACATGCATTATGTTAATGGAGG - Intronic
1045253534 8:100500584-100500606 TCCATGACTTTTCTTCATGGAGG - Intergenic
1046806913 8:118488742-118488764 TTCCTCCCTTCTCCTATTGGTGG + Intronic
1047518965 8:125579839-125579861 CTCATAGCTCCTCTTAATGGAGG - Intergenic
1048312322 8:133334918-133334940 TTCAAGTCTTCTCTTATTTGAGG + Intergenic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1050722052 9:8601321-8601343 TCCAGGCCTTCTTTTAAGGGTGG - Intronic
1051162271 9:14221938-14221960 TTCATGCTTTCTCTTAAACAGGG - Intronic
1052262631 9:26535520-26535542 TTTTTGCTTTTTCTTAATGGAGG - Intergenic
1058597069 9:106626606-106626628 TTCATGCCTTCTCTTCTTTCTGG + Intergenic
1058691086 9:107521419-107521441 TTTAAGCCTTCTCCCAATGGCGG - Intergenic
1059092816 9:111378948-111378970 TTCATTCCTACTATTAATGAAGG - Intronic
1059383563 9:113947072-113947094 CTCATGACTTCTGTCAATGGTGG - Intronic
1061314387 9:129785556-129785578 TTCATCCATTCTCTTAGTGATGG + Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186958999 X:14714449-14714471 TTTATTTCTTCTCATAATGGTGG - Intronic
1188444655 X:30243682-30243704 TTAAAGTCTTCTCTTAATGGAGG - Exonic
1189406007 X:40723753-40723775 TTCTTGTCTTCTTTTAATGAAGG - Intronic
1191039522 X:56064703-56064725 TTTATGCGTTTTCATAATGGTGG + Intergenic
1191891533 X:65947507-65947529 TTCATGTCTTCTGTTAAAGGAGG - Intergenic
1192268520 X:69556767-69556789 TTCTTCCCTTCTCTGAATGCCGG - Intergenic
1193277560 X:79606819-79606841 TTCATGACTTCTTTTAAGGCAGG - Intergenic
1196431804 X:115635109-115635131 TTCGTGCTCTCACTTAATGGAGG + Intronic
1198537942 X:137604673-137604695 TTCCTGCCTTCTTTTAGTGAAGG - Intergenic
1198785237 X:140281023-140281045 TTCCTGCCTTCTTTTAGTGAAGG + Intergenic
1199173671 X:144759262-144759284 CTGTTTCCTTCTCTTAATGGTGG - Intergenic