ID: 924205826

View in Genome Browser
Species Human (GRCh38)
Location 1:241710590-241710612
Sequence ACTAACAACCATCCTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924205826_924205834 -8 Left 924205826 1:241710590-241710612 CCCAAAGGAGGATGGTTGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 924205834 1:241710605-241710627 TTGTTAGTGGGGCTGGGGTCTGG 0: 1
1: 0
2: 5
3: 39
4: 430
924205826_924205835 -7 Left 924205826 1:241710590-241710612 CCCAAAGGAGGATGGTTGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 924205835 1:241710606-241710628 TGTTAGTGGGGCTGGGGTCTGGG 0: 1
1: 0
2: 1
3: 36
4: 385
924205826_924205837 30 Left 924205826 1:241710590-241710612 CCCAAAGGAGGATGGTTGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 924205837 1:241710643-241710665 GGCCTGTGCAAAAGCTCTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 184
924205826_924205836 9 Left 924205826 1:241710590-241710612 CCCAAAGGAGGATGGTTGTTAGT 0: 1
1: 0
2: 0
3: 7
4: 116
Right 924205836 1:241710622-241710644 GTCTGGGAGACAAACATCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924205826 Original CRISPR ACTAACAACCATCCTCCTTT GGG (reversed) Intronic
902359154 1:15932621-15932643 ATGATAAACCATCCTCCTTTTGG - Exonic
903425708 1:23252733-23252755 AATAACAACAATCATCTTTTAGG + Intergenic
905652438 1:39665553-39665575 ACTAACAACCATGCTCAAGTGGG - Exonic
909067516 1:70953337-70953359 AGGAACAACCATACTTCTTTAGG + Intronic
909380674 1:74995207-74995229 AGTTACAACCATCCACCTTATGG + Intergenic
910557590 1:88553055-88553077 TCTAAAAACCATCATCCTTATGG - Intergenic
911829330 1:102530945-102530967 ACTAAGTACAATCCTGCTTTTGG + Intergenic
912104804 1:106258889-106258911 ACTACCAACCTTTCACCTTTTGG + Intergenic
918875987 1:190044179-190044201 ATTATCAACCATCCTCCGTGAGG + Intergenic
920530933 1:206701915-206701937 TCTAACAATCATCCTGGTTTGGG - Intronic
922359605 1:224809450-224809472 ACTCTCAACCCTCCTCCTTTAGG - Intergenic
924205826 1:241710590-241710612 ACTAACAACCATCCTCCTTTGGG - Intronic
1063195940 10:3743477-3743499 AATAACAAACATCTTCCTTAGGG + Intergenic
1069232975 10:66035329-66035351 TCTCACCTCCATCCTCCTTTGGG + Intronic
1074482758 10:113840608-113840630 ACAAGCAACCCTCCTCCCTTTGG + Intronic
1079460723 11:20675688-20675710 AATAACATCCAAGCTCCTTTTGG + Intronic
1081176545 11:39933912-39933934 TCTAACAACTCTCTTCCTTTTGG + Intergenic
1081295309 11:41379414-41379436 ACTGCCAAACATCCTCCTGTTGG - Intronic
1085709914 11:78819920-78819942 ATTATCATCCATCCTCCTCTGGG - Intronic
1086254144 11:84854453-84854475 ACTACCAATCATACTACTTTTGG + Intronic
1095351083 12:41213399-41213421 AGCAACAGGCATCCTCCTTTTGG + Intronic
1097777130 12:63660873-63660895 TATAACAACCATACTCTTTTAGG + Intronic
1103566808 12:121820190-121820212 ATGGACACCCATCCTCCTTTTGG - Intronic
1110093257 13:71482015-71482037 CCTAAGAACCATCCTCCCCTTGG - Intronic
1111770260 13:92587458-92587480 AATAAAAACCATCCTCACTTTGG - Intronic
1115296880 14:31838374-31838396 ACAAATATCCATTCTCCTTTTGG - Intronic
1117292640 14:54348425-54348447 ACACCCGACCATCCTCCTTTTGG - Intergenic
1125090761 15:35789330-35789352 ACTAACACCAATTCTCCTTAAGG - Intergenic
1126400301 15:48261683-48261705 ACCATCAACCATTGTCCTTTTGG - Intronic
1126470007 15:48999356-48999378 ACTATCAACCATCATCTCTTTGG - Intronic
1130876238 15:88017257-88017279 TCTAACATCCATGCTTCTTTTGG - Intronic
1131137223 15:89946769-89946791 CCTAACAAACTTCCTGCTTTGGG + Intergenic
1132193860 15:99894801-99894823 AATAAAAACCATCCTCACTTTGG + Intergenic
1134117638 16:11561177-11561199 ACGACCAACCATGCTCCTTGAGG - Intronic
1135595795 16:23741941-23741963 ACAAAATACCATTCTCCTTTTGG - Intergenic
1137366982 16:47869173-47869195 ACTAACATGCATCCTACTATTGG + Intergenic
1139243414 16:65417553-65417575 AAGAACAACCATCCAGCTTTAGG - Intergenic
1141355789 16:83345495-83345517 GATATCAAACATCCTCCTTTTGG - Intronic
1141794416 16:86260616-86260638 ACCAACAACCATCCTTTTTCTGG + Intergenic
1144258209 17:13490827-13490849 AGTTCCATCCATCCTCCTTTGGG + Intergenic
1149564132 17:57629597-57629619 AGTAACAGCCCTCTTCCTTTAGG - Intronic
1151271405 17:72999111-72999133 ATGAGCCACCATCCTCCTTTTGG - Intronic
1151774973 17:76194489-76194511 ACTAAGAAGCGTCCTGCTTTCGG - Intronic
1153131276 18:1857727-1857749 ACAGATAACCATTCTCCTTTTGG - Intergenic
1154435714 18:14340116-14340138 ACAAACAAGCATCCACCTTGGGG - Intergenic
1162770927 19:12948945-12948967 ACTCACATCCAGCCTCCTGTGGG - Intronic
1164668070 19:30055241-30055263 ACAAAACACCATCCTACTTTTGG + Intergenic
1167140666 19:47648359-47648381 ACTGAGAATCATCCTCCTTCAGG + Intronic
926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG + Intergenic
927823085 2:26286478-26286500 ACAAACTACAATCTTCCTTTTGG - Intronic
929045780 2:37787592-37787614 AGTCACTACCATCCTTCTTTGGG + Intergenic
930211327 2:48641067-48641089 AGCAACAATCATCCTCTTTTAGG - Intronic
933635247 2:84701723-84701745 GCTTACCACCATCCTCCCTTTGG - Intronic
936889284 2:117350295-117350317 ACTGAAAACCATCTTCCTTGAGG - Intergenic
937863344 2:126730389-126730411 ACTAGGAACCAGCCTCCTCTGGG + Intergenic
941564389 2:167088238-167088260 ACTGACAAACTTCCTGCTTTAGG - Intronic
944084433 2:195827992-195828014 ACTACCAATCATCCTGCTTTAGG + Intronic
945364976 2:208941439-208941461 CCTAATAACCATGCTCCTGTAGG - Intergenic
947940550 2:234050986-234051008 ACTACGATCCATCCTCCTTAAGG + Exonic
948680974 2:239634460-239634482 ACTGACAACCATGCTCCCTTGGG + Intergenic
1171141150 20:22744048-22744070 ACTAACAATCTTCCTGTTTTGGG - Intergenic
1172011962 20:31850804-31850826 ACTACCACCCATCCTCCTCCAGG - Intronic
1172244764 20:33438337-33438359 CCCAAGACCCATCCTCCTTTGGG - Intronic
1176638844 21:9277202-9277224 AGTAATAACCATCCCACTTTAGG - Intergenic
1176841319 21:13845516-13845538 ACAAACAAGCATCCACCTTGGGG + Intergenic
1180422887 22:12884708-12884730 AGTAATAACCATCCCACTTTAGG - Intergenic
1183877079 22:40792201-40792223 AGTAACCACCATTCTACTTTCGG - Intronic
1184633146 22:45802023-45802045 TCTAATAACCAAGCTCCTTTGGG - Intronic
958099692 3:88993038-88993060 ACTAATTACCAGCGTCCTTTTGG + Intergenic
961469797 3:127104441-127104463 TCTAACAGCCATCCTCTTTCCGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967841373 3:194007589-194007611 ATATACTACCATCCTCCTTTGGG + Intergenic
1202748051 3_GL000221v1_random:127817-127839 AGTAATAACCATCCCACTTTAGG + Intergenic
970345092 4:15145483-15145505 GCTAAGAACCATCTTCCATTTGG - Intergenic
971205002 4:24557248-24557270 AAAAACAACTATCTTCCTTTTGG + Intronic
974641901 4:64642004-64642026 TCTTACAAACAGCCTCCTTTAGG + Intergenic
977928455 4:102727686-102727708 ACCTACAACCATCCTCCTGAGGG - Intronic
980520339 4:133924197-133924219 ACTATCATCCATCATCCTTTAGG + Intergenic
980880582 4:138706332-138706354 ACCAACAACCTTGCTTCTTTTGG - Intergenic
982303091 4:153900111-153900133 ACAAACAACCATTCCCCTTTGGG + Intergenic
982700124 4:158651491-158651513 ACTAACAAAAATATTCCTTTAGG - Intronic
984349722 4:178575339-178575361 TCGATCAACCATTCTCCTTTGGG + Intergenic
984797538 4:183677436-183677458 ATTAACCACCCTCCTCATTTAGG + Exonic
985968723 5:3357961-3357983 ACTAACAGCCTTCCTACTTGTGG + Intergenic
988210046 5:28192333-28192355 ACTAAAAGCAATCTTCCTTTGGG + Intergenic
992008758 5:72506769-72506791 ACAATTAACAATCCTCCTTTAGG + Intronic
997126215 5:131229607-131229629 ACAAACAAACAACCTACTTTAGG - Intergenic
1002704642 5:181152112-181152134 ACTCACATCCATTTTCCTTTTGG + Intergenic
1002967704 6:1983491-1983513 TCTAACATCCATCATCCATTAGG + Intronic
1003871553 6:10407453-10407475 ACTAACAACAAACCTGCTGTTGG - Intronic
1004820765 6:19365686-19365708 ACCATCAACCTTCATCCTTTAGG + Intergenic
1005068162 6:21838990-21839012 ACTAACAACCATCAAACTGTAGG - Intergenic
1005526707 6:26658571-26658593 ACTCAAGACCATCTTCCTTTTGG + Exonic
1011048483 6:83115074-83115096 CCTAACAACTATCATCCTTTTGG - Intronic
1012868624 6:104646802-104646824 ATTAAGACCCATACTCCTTTGGG + Intergenic
1022361283 7:29660891-29660913 TATAACAACCATACTCTTTTAGG - Intergenic
1022936046 7:35178547-35178569 TATAACAACCATACTCTTTTAGG + Intergenic
1026142348 7:67717255-67717277 ACTAACACCTCTCCTCCCTTGGG + Intergenic
1027776645 7:82473404-82473426 ACTATCAAGCATCTTGCTTTGGG + Intergenic
1028516639 7:91684692-91684714 CCTAACAACCCTCTTACTTTAGG + Intergenic
1029353291 7:100030797-100030819 ACTACCAAGCATCCTTCTGTTGG + Intronic
1029832010 7:103271264-103271286 TATAACAACCATACTCTTTTAGG + Intergenic
1032795483 7:135272649-135272671 AGCAACCACCATTCTCCTTTTGG - Intergenic
1034952469 7:155308642-155308664 ACCATCAACCTACCTCCTTTGGG - Exonic
1037783811 8:21889929-21889951 ACCCACAAGCATTCTCCTTTTGG + Intergenic
1038995812 8:32921851-32921873 ACTAAGAAGCATCCTTTTTTTGG + Intergenic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1046178214 8:110607103-110607125 ATTAACAACCATGCCCTTTTTGG + Intergenic
1048775375 8:137940036-137940058 AGTCACAACCAGCCTCCTTAGGG + Intergenic
1052806264 9:33016487-33016509 CATTACAACCATCTTCCTTTAGG + Intronic
1052833028 9:33230908-33230930 ACCAGCAACATTCCTCCTTTCGG + Intronic
1053055575 9:34991466-34991488 ACCAACCACCCACCTCCTTTTGG - Intronic
1056624044 9:88239093-88239115 CCTAAGAACCATCCTCCTCTAGG + Intergenic
1057682241 9:97199770-97199792 ACTCAAGACCATCTTCCTTTTGG + Intergenic
1203716690 Un_KI270742v1:157900-157922 AGTAATAACCATCCCACTTTAGG + Intergenic
1186528162 X:10268572-10268594 CATAACACCCACCCTCCTTTGGG - Intergenic
1187404248 X:18988286-18988308 TCTGAGAAGCATCCTCCTTTGGG - Intergenic
1187712772 X:22070807-22070829 ACTTAAAAACACCCTCCTTTGGG - Intronic
1188460149 X:30416133-30416155 TTCAACAACCATCCTCCATTTGG - Intergenic
1191862894 X:65680458-65680480 ATTTAAAACCATTCTCCTTTGGG + Intronic
1195740497 X:108060424-108060446 AATAACAACCATCCCCCTAAAGG + Intronic
1195839925 X:109163528-109163550 AATAACAACCATTCTACTTGTGG + Intergenic
1198892391 X:141412456-141412478 ATGATCAATCATCCTCCTTTTGG - Intergenic
1201951660 Y:19571835-19571857 ACAAGGCACCATCCTCCTTTGGG - Intergenic