ID: 924206509

View in Genome Browser
Species Human (GRCh38)
Location 1:241717044-241717066
Sequence CATGATGTAAGATCACCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924206498_924206509 26 Left 924206498 1:241716995-241717017 CCTCATCATCCAGGAATGATAAT 0: 1
1: 0
2: 1
3: 14
4: 182
Right 924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 60
924206503_924206509 2 Left 924206503 1:241717019-241717041 CCCATTTCAGGGGATGTCCCACC No data
Right 924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 60
924206504_924206509 1 Left 924206504 1:241717020-241717042 CCATTTCAGGGGATGTCCCACCA No data
Right 924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 60
924206499_924206509 17 Left 924206499 1:241717004-241717026 CCAGGAATGATAATGCCCATTTC 0: 1
1: 0
2: 1
3: 11
4: 154
Right 924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 60
924206497_924206509 30 Left 924206497 1:241716991-241717013 CCAGCCTCATCATCCAGGAATGA 0: 1
1: 0
2: 1
3: 15
4: 205
Right 924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924206509 Original CRISPR CATGATGTAAGATCACCTAT GGG Intronic
906215810 1:44037847-44037869 CATGATGTAAGAGCAACGGTGGG + Intergenic
924206509 1:241717044-241717066 CATGATGTAAGATCACCTATGGG + Intronic
1064586508 10:16844502-16844524 CGTGATGTAAGATCAGATTTGGG + Intronic
1069237456 10:66094897-66094919 CATGTTGTATGATTAGCTATGGG + Intronic
1075180003 10:120202475-120202497 CATCATGTAAAAACACCCATAGG - Intergenic
1087594783 11:100238803-100238825 AATGAGCTTAGATCACCTATTGG - Intronic
1096646180 12:53037680-53037702 AATGATGGAAGATCTCCTACGGG + Intronic
1098879839 12:75905858-75905880 TTTGATGTTACATCACCTATAGG + Intergenic
1100234352 12:92643939-92643961 GATTATGTGAGATCTCCTATAGG + Intergenic
1100564468 12:95782008-95782030 CATCATTTAAGATCCTCTATTGG + Intronic
1111060666 13:83014756-83014778 CATTATATAAGATTACCTAGAGG + Intergenic
1115101920 14:29711930-29711952 CATGATGGAAGATCTCATGTGGG + Intronic
1123162862 14:106296619-106296641 CATGATGAAAAATCACCTAATGG - Intergenic
1130415912 15:83694530-83694552 CTTGAAGTAAGCTGACCTATTGG - Intronic
1132124580 15:99211558-99211580 CCTGATTTAAAATCACCTCTGGG + Intronic
1136772446 16:32853141-32853163 CATGATGAAAAATCACCTAATGG + Intergenic
1136898169 16:34008376-34008398 CATGATGAAAAATCACCTAATGG - Intergenic
1138779930 16:59771434-59771456 AATAATGTAGGATCAACTATAGG - Intergenic
1203074868 16_KI270728v1_random:1115239-1115261 CATGATGAAAAATCACCTAATGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1150971623 17:70034939-70034961 CATGATATAAAATCAGATATAGG + Intergenic
1155085405 18:22453229-22453251 TATTATGTAACATCCCCTATTGG - Intergenic
1157145628 18:45159569-45159591 CATCATGTAAGGCCACCTAGGGG + Intergenic
1160705570 19:528636-528658 CATGATGCAGGATCACTAATAGG + Intergenic
930221664 2:48752691-48752713 CCTGAGGTAAGAAGACCTATGGG - Intronic
930297634 2:49575187-49575209 CAATATGTAAGACCAACTATTGG + Intergenic
930368276 2:50471221-50471243 AATGATGAAAAAACACCTATTGG - Intronic
930465760 2:51747593-51747615 CATGATTTACCATCTCCTATTGG + Intergenic
935574840 2:104698564-104698586 CATGATGTAAAATCACGCGTTGG - Intergenic
936558606 2:113517247-113517269 CATGGTGTAAGATTACTCATGGG - Intergenic
943442745 2:187945786-187945808 CTTGATTTGAGATCTCCTATTGG + Intergenic
947253553 2:228135958-228135980 CATGTTGTAAAGTCACCTATTGG - Intronic
948719816 2:239892481-239892503 AATGCTGTAAGATGACGTATGGG + Intronic
1169642288 20:7767289-7767311 CTTTTTATAAGATCACCTATTGG - Intergenic
1169976074 20:11329424-11329446 AATGATGTGAGATGAACTATTGG + Intergenic
1172020105 20:31908097-31908119 GATGATCCAAGATCACCTTTGGG + Intronic
1176524829 21:7858137-7858159 CATGATGTAACACCCCCTTTGGG - Intergenic
1177264691 21:18767070-18767092 CAGTATGTGAGATCACCTTTTGG + Intergenic
1178658849 21:34488150-34488172 CATGATGTAACACCCCCTTTGGG - Intergenic
950979662 3:17289015-17289037 CATGCTGTAACATCCCCTCTGGG + Intronic
957278873 3:78124657-78124679 CTTGGTGTAAGATCACTTCTTGG + Intergenic
958485384 3:94699843-94699865 CTAGCTGAAAGATCACCTATTGG + Intergenic
958906900 3:99951717-99951739 CATGATCTAAGGGTACCTATTGG - Intronic
967086459 3:186099163-186099185 CATAATGTAAGTACACCTTTGGG - Intronic
972597520 4:40543076-40543098 GATCATGTACTATCACCTATAGG + Intronic
980225202 4:129974582-129974604 GGTGATTTAAAATCACCTATTGG - Intergenic
980630235 4:135422199-135422221 CATGATATAATATCTTCTATTGG + Intergenic
990626490 5:57618547-57618569 AATGATGTAAGATGACTTTTTGG + Intergenic
990845172 5:60129530-60129552 CATGATGTAAGAGCCCATCTAGG + Intronic
1000610167 5:163365224-163365246 CATGCTGTAACAACCCCTATAGG + Intergenic
1001134852 5:169093998-169094020 CATGATGTGAGTTCACAGATAGG - Intronic
1006323577 6:33336061-33336083 GATGATGTAAGATGCCATATTGG + Intergenic
1014338676 6:120174085-120174107 CATGATGTTGGATCATCTATTGG - Intergenic
1027955598 7:84875286-84875308 CAGGATCTAAGATTACCTACAGG - Intergenic
1042078771 8:65026226-65026248 CCTCATGTCAGTTCACCTATAGG - Intergenic
1049894240 9:98908-98930 CATGGTGTAAGATTACTCATGGG + Intergenic
1052246351 9:26340354-26340376 TATGATATAAGATCAAATATTGG - Intergenic
1053611850 9:39721958-39721980 CATGATAAAAGATTAACTATAGG + Intergenic
1053869890 9:42479958-42479980 CATGATAAAAGATTAACTATAGG + Intergenic
1054086406 9:60749197-60749219 CATGATAAAAGATTAACTATAGG - Intergenic
1054241671 9:62620435-62620457 CATGATAAAAGATTAACTATAGG - Intergenic
1054555797 9:66654958-66654980 CATGATAAAAGATTAACTATAGG - Intergenic
1056667562 9:88593121-88593143 CATGATTAAAAATGACCTATCGG + Intergenic
1059752021 9:117256606-117256628 CTTGATGTAAGATCAAATAATGG + Intronic
1187401562 X:18965024-18965046 CATGATGAATGATGGCCTATAGG + Intronic
1187871998 X:23772243-23772265 CATGATGTAAGATTCTCTCTTGG + Intergenic
1200036898 X:153336774-153336796 CATGTTGTAACCCCACCTATAGG - Intronic