ID: 924207210

View in Genome Browser
Species Human (GRCh38)
Location 1:241725597-241725619
Sequence GCCTGGGAGGAACCCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924207210_924207215 -2 Left 924207210 1:241725597-241725619 CCTTTGAGGGGTTCCTCCCAGGC 0: 1
1: 0
2: 2
3: 8
4: 146
Right 924207215 1:241725618-241725640 GCTAGAGAGGAAAATGCACCCGG 0: 1
1: 0
2: 0
3: 17
4: 187
924207210_924207220 27 Left 924207210 1:241725597-241725619 CCTTTGAGGGGTTCCTCCCAGGC 0: 1
1: 0
2: 2
3: 8
4: 146
Right 924207220 1:241725647-241725669 CCTCCTCCAGTTCACAACTGAGG 0: 1
1: 0
2: 2
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924207210 Original CRISPR GCCTGGGAGGAACCCCTCAA AGG (reversed) Intronic
900292574 1:1929768-1929790 GCCTGGCCGGAACCCATCCAGGG - Intronic
901720250 1:11191683-11191705 TTCTGGGAGGAAGGCCTCAAAGG + Intronic
902387817 1:16085793-16085815 GCCTGGGAGGCTCCCTTGAAGGG - Intergenic
905239016 1:36570727-36570749 GCCTGGGATGACGCCCTCCAAGG + Intergenic
905915825 1:41683628-41683650 GGCTGGGAGGAAGCCCACAATGG + Intronic
908642900 1:66245003-66245025 GCCTTGGTGGAAACCCTGAATGG + Intronic
910667224 1:89738874-89738896 GCCTGGGAGCAGCCCCTCCCAGG - Intronic
911044809 1:93619629-93619651 GCATGGGAGGGACCTCTGAAGGG - Intronic
913536283 1:119775611-119775633 GACGGGGAGGAACCCCACAGTGG - Intergenic
914450885 1:147790562-147790584 GCCTGGAAGAAACCCCTCTTGGG + Intergenic
917498834 1:175567392-175567414 TCCTGGGAGGCAGCCCTGAAAGG - Intronic
917662025 1:177186213-177186235 GCATGGGAGGTATCCCTGAAGGG + Intronic
918388685 1:184036779-184036801 GCATGGGGGACACCCCTCAAGGG - Intronic
919860969 1:201739474-201739496 GGCCGGGAGGAAGCCCTCTATGG + Intronic
920988702 1:210915143-210915165 GCTTTTGAGGAATCCCTCAAAGG - Intronic
922542975 1:226433135-226433157 GCCTGGGGGAAACCCCTAGAGGG + Intergenic
922610032 1:226919715-226919737 GCCTGGCACCAACCCCTCAGGGG - Intronic
922737811 1:227998785-227998807 GCTAGGGAGGAAGCCCACAAAGG + Intergenic
922749916 1:228065459-228065481 TCCTTGGAGGACCCCCTCCAAGG - Intergenic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
924935217 1:248762360-248762382 AACTGGGAGGCACCCCTCAGTGG + Intergenic
1064335385 10:14436018-14436040 GTATGGGTGGAACCCATCAAAGG - Intronic
1069749273 10:70735229-70735251 GCCTGGGATCAACTACTCAATGG + Exonic
1070156326 10:73837808-73837830 GCCTGGGTGGAAGCTGTCAAAGG - Intronic
1074440866 10:113476478-113476500 GCCTGTGATTAAGCCCTCAAAGG - Intergenic
1076423685 10:130352080-130352102 GCCTGCGATGAGCCCCACAAAGG - Intergenic
1080588402 11:33700758-33700780 GCGTGGGAGGAACCCCGCGCCGG + Exonic
1083572384 11:63767688-63767710 GGCCTGGAGGAAACCCTCAAGGG + Intronic
1083597079 11:63923063-63923085 ATCTGGGAGGAACCCCTTCATGG + Intergenic
1083805600 11:65072041-65072063 GCCTGTGATTAACCCCTCAAAGG - Intronic
1088846829 11:113675311-113675333 GCCTGAGCAGAAACCCTCAAGGG + Intergenic
1091584851 12:1810339-1810361 TCCTGGGAGGAAACCCAGAAGGG + Exonic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1092237710 12:6820453-6820475 GCCTGAGAGGGAACCCTCTAAGG + Exonic
1093255537 12:16862632-16862654 GCCTGTCAGGAACTCATCAAAGG + Intergenic
1097493734 12:60301561-60301583 GCAAGGGAGGAATGCCTCAATGG + Intergenic
1099467539 12:83005723-83005745 GCCTGGGAGCAACCCCACCCTGG - Intronic
1102608186 12:114086919-114086941 GCCAGGGAAGAACCACCCAAAGG - Intergenic
1103323104 12:120102920-120102942 CGCTGGGAGGGACCCCTCCAGGG + Intronic
1104639329 12:130457445-130457467 ACCTGGGAGGAAGCCCACAAGGG - Intronic
1104918707 12:132279486-132279508 GCCTGGCAGGAAGCCCACAGCGG - Intronic
1106916788 13:34524384-34524406 GCCAGGGAGAGACCCCTCATTGG - Intergenic
1107062480 13:36174493-36174515 GCCTGGGAGAGACAGCTCAATGG + Exonic
1111680213 13:91433176-91433198 GCCTGGGAAGAAGCAGTCAATGG - Intronic
1111985690 13:95064687-95064709 GCCAGGATGGACCCCCTCAAAGG + Intronic
1118609222 14:67527112-67527134 GCCTGGAAGGTGCCCCGCAAGGG + Intronic
1119333789 14:73815406-73815428 CCCTGCCATGAACCCCTCAAGGG + Intergenic
1120283114 14:82463981-82464003 GCCTGGGATGAACTCCTCGCAGG + Intergenic
1122830206 14:104392284-104392306 CCCTGGCAGGACCCCCTCATGGG + Intergenic
1122842073 14:104470853-104470875 GCCTGGGAGTCACAGCTCAATGG - Intergenic
1122994242 14:105254001-105254023 GCCTGGCAGGAACCCAGCACAGG - Intronic
1123018601 14:105387119-105387141 TCCTGGAAGGAACCCAGCAAAGG + Intronic
1127177990 15:56382233-56382255 GCCTGGGACTCACCCTTCAAGGG + Intronic
1129293623 15:74587311-74587333 TCCTTGGAGGTACCTCTCAAAGG - Intronic
1131905632 15:97139011-97139033 GACTGTGAGGAACTCCACAAAGG - Intergenic
1136015675 16:27399255-27399277 GACCCAGAGGAACCCCTCAAGGG + Intergenic
1138584223 16:57960102-57960124 GGGTTGGAGGAAGCCCTCAAGGG - Intronic
1140914850 16:79484058-79484080 GAATGGGAGGAAGCTCTCAAAGG - Intergenic
1144268525 17:13594918-13594940 GTCAGGAAGGAACCCCTAAAGGG - Intronic
1148471909 17:47899549-47899571 ACCTGGGAGCATCTCCTCAAGGG - Intronic
1149559939 17:57601407-57601429 GCCAGGGAGGATCCCCTCTCTGG - Intronic
1152000363 17:77641450-77641472 GCCGGGGAGTGACCCCTGAAGGG + Intergenic
1152282774 17:79395289-79395311 GCCTGGGAGGACCCCTCCTAAGG + Intronic
1154111457 18:11572055-11572077 GCCTGGGAAGAACCCCTTTGCGG + Intergenic
1156494721 18:37518170-37518192 GCCAGGGAGGAGCCACCCAAGGG - Intronic
1157592285 18:48843070-48843092 GGGTGGGAGGCTCCCCTCAAAGG - Intronic
1158535265 18:58302826-58302848 GCCTGGGAGGACCCCTCCCACGG + Intronic
1159201517 18:65191617-65191639 ACCTGGGATGAACTTCTCAATGG - Intergenic
1164748575 19:30634447-30634469 GCATGGCAGGAACTTCTCAAGGG - Intronic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
1167384411 19:49155585-49155607 GCCAGGGAGAGACCCCTCACTGG - Intergenic
1167990744 19:53358425-53358447 GCCTGGGAGGAACCCTGATAAGG - Intergenic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926170828 2:10551605-10551627 GCATGGGAAGAACGCCTCAAGGG + Intergenic
927139239 2:20118415-20118437 GCCCGGCAGGGACCCCTCAGAGG - Intergenic
930773849 2:55153847-55153869 GGCTGTCAGCAACCCCTCAAGGG - Intergenic
932104130 2:68927425-68927447 GCCTGGGAGTTACCACTAAAGGG - Intergenic
933937280 2:87217000-87217022 GACTGGGAGGTACGGCTCAATGG + Intergenic
938128122 2:128689108-128689130 AACTGGGAGGAACACTTCAATGG - Intergenic
945592460 2:211750759-211750781 GACTAGGAGTAACTCCTCAAAGG + Intronic
946984779 2:225258780-225258802 GTCTGGGAGAAATCCCTGAAGGG + Intergenic
947587820 2:231367453-231367475 GCCTGGGAGGCAGCCCTCAAAGG - Intronic
1169569307 20:6889117-6889139 TCCTGGGAGGAGAGCCTCAACGG - Intergenic
1171108358 20:22457557-22457579 CCCTTGGAAGAACCCCTCACTGG + Intergenic
1172845313 20:37926739-37926761 GCCAGGGAGTAACCCTTCCACGG - Intronic
1173755013 20:45508270-45508292 GCCTGGGGGACACCCCTCACTGG + Intergenic
1175268118 20:57714816-57714838 GCCAGGGAGGACCCAGTCAAAGG - Intergenic
1175315722 20:58045290-58045312 GCCTGGGAGGACCATGTCAATGG - Intergenic
1175745209 20:61451723-61451745 GGCTGGGAGGAAGGCCTCCAGGG + Intronic
1176365479 21:6030148-6030170 CCCTGGGAGGAACACCTGGATGG - Intergenic
1176930191 21:14800816-14800838 AACTGGGAGGCACCCCTCAGTGG + Intergenic
1177557983 21:22716210-22716232 GCCTCAGAGCCACCCCTCAAAGG + Intergenic
1179731897 21:43372746-43372768 GTCTGGCAGGGACCCCTCAGAGG + Intergenic
1179758039 21:43508397-43508419 CCCTGGGAGGAACACCTGGATGG + Intergenic
1182470501 22:30545162-30545184 GCCTGGGAGGAGTCCCTTGAAGG - Intronic
1184287759 22:43481622-43481644 GCCTGGGAGGAACCCCAGAAAGG - Intronic
1184786216 22:46673240-46673262 GCCTGGGAGTGACCACTCCATGG + Intronic
949982050 3:9508162-9508184 GCCTGGGAGCATTCCCTCCATGG - Intronic
950767599 3:15284816-15284838 GCCTGGGAGAGACCCATAAAAGG + Intronic
951707320 3:25556406-25556428 GACTGAGAGTGACCCCTCAATGG + Intronic
953422401 3:42764703-42764725 GCCTGGGAGGAAGGCCTCCCAGG - Intronic
953875460 3:46664172-46664194 GCCTGGGAGGAACCATGCATGGG - Intergenic
954070746 3:48141295-48141317 GCCTGGGAGATACTCCCCAAAGG - Intergenic
954684165 3:52361554-52361576 ACTTGGGAGGAAGCCCTCAGGGG - Intronic
955934700 3:64091457-64091479 GCCCTGGAGGTACCCCTCTAGGG - Intergenic
960596958 3:119415389-119415411 TCCTGGGAGTAAACCCTCCAGGG - Exonic
962876901 3:139542065-139542087 GCCTGGGAGGAGACCCAGAAGGG - Intergenic
963237792 3:142972603-142972625 GTCTGGGAGGAAAGCCTCCAAGG - Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
966695026 3:182780705-182780727 GCCTGGGAAGTGCCCATCAATGG + Intergenic
969618334 4:8266512-8266534 CTCTGGGAACAACCCCTCAAGGG - Intergenic
976423246 4:84870411-84870433 AACTGGTAGGAACACCTCAATGG + Intronic
976734362 4:88295582-88295604 GACTGAGAGGAAGCACTCAAGGG + Intergenic
977720992 4:100240216-100240238 GCCTCAGAGTCACCCCTCAAGGG + Intergenic
985615401 5:917021-917043 GGCCTGGAGGAACCCCTCTATGG - Exonic
989260251 5:39411542-39411564 GCCTTGGAGGATCCACTCCATGG + Intronic
990740614 5:58908832-58908854 GCCATGGAGGGACCCCTCAGTGG + Intergenic
995811076 5:116108113-116108135 GACTGGGAGAAACCCCACAGTGG - Intronic
1001160332 5:169306962-169306984 GCATGGGAGGAACCACTCCTAGG - Intergenic
1002211524 5:177602206-177602228 GCCTGGTAGGAAACCCCCCAGGG - Intronic
1007058637 6:38915017-38915039 GACTGCGAGGAACTGCTCAAAGG + Intronic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1013468943 6:110443761-110443783 GCATGGAAGCAACCCCCCAAGGG + Intronic
1014674539 6:124348243-124348265 GCCTGAGAGGCACCCCCCAGTGG - Intronic
1017976088 6:159358693-159358715 GCATGGGAGGAGCCCCACCAGGG - Intergenic
1022473038 7:30693381-30693403 GCCTCCGTGAAACCCCTCAAAGG + Intronic
1022520083 7:31000543-31000565 GCCTGGAAGGAACCCTGCAGAGG - Intergenic
1023888125 7:44375171-44375193 CCCTGGGAGGGTCCCCTCAGAGG - Intergenic
1029424474 7:100487338-100487360 GCCTGAGATGAACCATTCAAGGG + Intronic
1033531590 7:142269507-142269529 CCCTGGCAGGAATCCCTCTATGG + Intergenic
1034312272 7:150099391-150099413 GCCTGGGAGGAAGACTTGAATGG - Intergenic
1034794580 7:154001267-154001289 GCCTGGGAGGAAGACTTGAATGG + Intronic
1035942823 8:3922952-3922974 GCCCTGGATGAACACCTCAAGGG - Intronic
1037450378 8:19010909-19010931 GTCCGGGAAGAACCCCTAAATGG + Intronic
1038499086 8:28028568-28028590 GCCAGGGAGGAAGCCCACAGTGG + Intronic
1045300086 8:100903447-100903469 GCTTGGAAGGAACCCAGCAAGGG + Intergenic
1047492919 8:125389070-125389092 GCCTGGGAGCCACCCCACACAGG + Intergenic
1048141497 8:131799268-131799290 GGCTGGGAGGAATCCATCATGGG + Intergenic
1049640271 8:143712149-143712171 AAGTGGGAGGAACCCCTCACAGG - Intronic
1057481206 9:95447070-95447092 GCCTGGGCGGAACCCCCGAGGGG - Exonic
1059991896 9:119873383-119873405 GCCTAGGAGAAGCTCCTCAAAGG - Intergenic
1060113824 9:120925873-120925895 GCCAGGGAGGGACCCCTGATGGG - Intronic
1060946336 9:127571224-127571246 GCCAGGGAGGAACCCGTCCCTGG - Intronic
1060946346 9:127571247-127571269 GCCAGGGAGGAACCCGTCCCTGG - Intronic
1061153988 9:128846083-128846105 GCCTGGGAGGAACACCGGGAGGG - Intronic
1061506720 9:131035832-131035854 GCCTGGGAGGAGCCCCACCTGGG - Intronic
1185498334 X:576571-576593 GCCTGGGAGGAAGTCCTGGAGGG + Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1190588109 X:51967575-51967597 GCCTGGCAGAAACCCCTATAGGG - Intergenic
1191802774 X:65099428-65099450 GACTGGGAGAAACCTCCCAATGG + Intergenic
1192169803 X:68847138-68847160 TCCTGGGAGACACCCCTCAGTGG + Intergenic
1195709956 X:107765780-107765802 GCCTGGGAGGAGTCCCACAAAGG + Intronic
1197867628 X:131035931-131035953 TCTTGGGAGGAACCCCTCCCTGG + Intergenic
1199759125 X:150891858-150891880 GCCTGGGAGGACTGGCTCAAGGG - Intronic
1200836532 Y:7737683-7737705 GCCTGTGAGGAACAACTCAATGG + Intergenic