ID: 924208915

View in Genome Browser
Species Human (GRCh38)
Location 1:241744581-241744603
Sequence CTTTCGTTCTTTAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924208907_924208915 28 Left 924208907 1:241744530-241744552 CCAGAATGTGGCGTCCCTGCTTT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
924208910_924208915 0 Left 924208910 1:241744558-241744580 CCTGAGAATTTCCGCCAAAAACT 0: 1
1: 0
2: 1
3: 7
4: 120
Right 924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
924208908_924208915 14 Left 924208908 1:241744544-241744566 CCCTGCTTTAGTGTCCTGAGAAT 0: 1
1: 0
2: 4
3: 238
4: 7822
Right 924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
924208909_924208915 13 Left 924208909 1:241744545-241744567 CCTGCTTTAGTGTCCTGAGAATT 0: 1
1: 0
2: 0
3: 33
4: 652
Right 924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924208915 Original CRISPR CTTTCGTTCTTTAGGGTAGA AGG Intronic
902273229 1:15320901-15320923 CTTTCCTTCTTTTGAGTTGATGG + Intronic
908663203 1:66460937-66460959 CTTTTGTTCCTTAGGGTAGAAGG + Intergenic
911116665 1:94252745-94252767 CCTTCCTTCTTTAAAGTAGAGGG + Intronic
912865792 1:113255160-113255182 CTTTTCTTCTTTAGTGGAGAGGG + Intergenic
913056629 1:115168021-115168043 CTTTCATTCTTTAGGCAACAGGG - Intergenic
916573890 1:166050499-166050521 TTTTCCATCTTTAGGGGAGATGG + Intergenic
917133074 1:171762072-171762094 CTTTCCTTCTTTAGTGGACATGG - Intergenic
919888975 1:201956111-201956133 AATTCTTTCTTGAGGGTAGAGGG + Intronic
920532977 1:206717997-206718019 GTTTTGTTTTTTAGGGAAGAGGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
1065802891 10:29368553-29368575 ATTTCTTTCTTTTGGGGAGAGGG - Intergenic
1066702791 10:38147750-38147772 CTTTTTTTCTCTTGGGTAGAAGG - Intergenic
1073728923 10:106268152-106268174 CTCTCTTTCTTTTGGGTAAAAGG + Intergenic
1074125416 10:110525364-110525386 CTGTCTTTCTTTTGGATAGAGGG - Intergenic
1074513546 10:114141943-114141965 CTTTTGTTTTTTAAGGTAGAAGG + Intronic
1079965237 11:26971651-26971673 CTTTCTTTTTGTAGTGTAGATGG - Intergenic
1081107208 11:39085189-39085211 CTTTCTTTCTTTGGGGAAGTGGG - Intergenic
1081302076 11:41464843-41464865 TTTTCTTTCTTTAGGGGGGAAGG + Intergenic
1081875378 11:46404807-46404829 CTTTCATTCTTTTGGGGGGATGG - Intronic
1082787635 11:57325499-57325521 CTTTTGTTCTTACGGGAAGAAGG - Intergenic
1085466684 11:76728745-76728767 TTTTTGTTCTTTAGGAGAGAGGG + Intergenic
1085617178 11:78009591-78009613 TTTTCGTTGTTTCAGGTAGAAGG + Intergenic
1085943543 11:81237073-81237095 CATTTTTTTTTTAGGGTAGAAGG + Intergenic
1086093814 11:83030625-83030647 CTTTTGTTTTTTAGTGGAGATGG - Intronic
1086171529 11:83842256-83842278 CTTTCTCTCTTTACGGCAGATGG + Intronic
1086782784 11:90928926-90928948 CTTTCGTTCTTTTGGGCAAAAGG + Intergenic
1092926034 12:13273250-13273272 CTTGTGTTCGTTAGGGTAAATGG + Intergenic
1093370218 12:18356123-18356145 CTCTCTTTCTTTTGGGTAAAAGG - Intronic
1093621633 12:21297259-21297281 CTTTCTTTCTTGAGATTAGAAGG + Intronic
1095925375 12:47573898-47573920 CTTTCTCTCTTTTGGGTAGGAGG - Intergenic
1099532523 12:83801951-83801973 CTTTCATTCTCTGTGGTAGAGGG - Intergenic
1099774704 12:87110443-87110465 CTTTCTGTCTTTTGGGTATATGG + Intergenic
1100441844 12:94624540-94624562 TTTTCGTTTTTTAGTGGAGACGG - Intronic
1104098001 12:125577668-125577690 CTCTAGTTCTCTAAGGTAGAAGG + Intronic
1109207687 13:59500295-59500317 CTATCATCATTTAGGGTAGAAGG + Intergenic
1109739315 13:66531206-66531228 CTTTTGTTCTTTAGCCTAGCCGG - Intronic
1110176431 13:72561557-72561579 CATCTGTTCTTTATGGTAGAGGG + Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1111926687 13:94470479-94470501 ATTTCATTCCTTAGGTTAGAGGG + Intronic
1116689769 14:48090611-48090633 CTTTTGTTCTTTCGGTTAAAAGG - Intergenic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1120108141 14:80519829-80519851 ATTGAGTTCTTTAGTGTAGATGG - Intronic
1120928419 14:89821553-89821575 TTTTCATTCTTTATGGCAGAAGG - Intronic
1125505347 15:40264859-40264881 CTTGCCTTCTTTGGGGTCGAAGG - Exonic
1126749947 15:51866458-51866480 CTTTCTTTTTTTTGGGTAGGGGG - Intronic
1134830439 16:17318476-17318498 CTTTCCTCCTGCAGGGTAGAAGG + Intronic
1137329827 16:47482046-47482068 CTTTCATTCTTTAGTGAATAAGG - Intronic
1138284175 16:55795170-55795192 ATTTTGTTCTTTAGGGGTGAAGG - Intergenic
1138284827 16:55801817-55801839 ATTTTGTTCTTTAGGGGTGAAGG + Intergenic
1138403006 16:56763846-56763868 TTTTTTTTCTTTTGGGTAGAAGG - Intronic
1139710980 16:68775907-68775929 CTTTCCTCCTTTTGGGTGGATGG - Intronic
1143230684 17:5351864-5351886 ATTTTGTTCTTGAGTGTAGATGG + Intronic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1148020442 17:44549719-44549741 CCTTCCCTCTTTAGGGTGGAGGG + Intergenic
1150516086 17:65810862-65810884 CTTCCCTCCTTTAGGGTAGATGG - Intronic
1153053015 18:918065-918087 TCTTCCTTCTTTAAGGTAGATGG + Intergenic
1156113872 18:33762469-33762491 CTTGCATTCCTTTGGGTAGAAGG + Intergenic
1156558683 18:38096866-38096888 CCTTAATTCTATAGGGTAGAGGG + Intergenic
1157047728 18:44123011-44123033 CTTTCGTTTTTTATGATAGGTGG + Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
928104910 2:28463520-28463542 CTTTGATTCTTTAGGCCAGAAGG + Intronic
928586351 2:32762354-32762376 GGTTAGTTTTTTAGGGTAGAAGG + Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
933128364 2:78640295-78640317 CTTACTTTCTCTAGGGTAGCTGG + Intergenic
933513363 2:83269551-83269573 CTTTCACTCCTCAGGGTAGAGGG - Intergenic
934921535 2:98348103-98348125 TTTGCGTTCTTTGGGGTAGGGGG + Intronic
935595837 2:104876881-104876903 CTTTCGCTCTTCAGGGTTCAGGG + Intergenic
936888577 2:117342068-117342090 CTTTGGTGTTTTAGGATAGAAGG - Intergenic
939143398 2:138382058-138382080 CTTTGGCTCTTTAGGGTCGTTGG - Intergenic
941931128 2:170940275-170940297 CTTTGTTACTTTAAGGTAGAAGG + Intronic
942122460 2:172791929-172791951 CTTTCTTTCTTTGTGGAAGATGG + Intronic
942239519 2:173946885-173946907 CTTTTTTTTTTTAAGGTAGACGG + Intronic
942523833 2:176831964-176831986 CTTCAGTTGTTTTGGGTAGAGGG - Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
1180895479 22:19328844-19328866 CTTTGGTTGTTTCAGGTAGAAGG + Intergenic
1181909441 22:26226885-26226907 GTTTCATTCTTCATGGTAGAAGG - Intronic
1182085381 22:27557597-27557619 CTTTTCTTCTTTAGGGAGGAAGG - Intergenic
1183472738 22:38018176-38018198 CTTTCGTTCATTCTGGGAGAGGG + Intronic
951053835 3:18124602-18124624 CTTTCTTTCTTTTGGGCACATGG + Intronic
951714988 3:25632786-25632808 TTTTTTTTCTTTAGGGTGGACGG - Exonic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
953201038 3:40778956-40778978 CTTTGGTTCTTTAGACCAGAGGG + Intergenic
953573227 3:44089668-44089690 CTGTCATTCTTTAGGGTCCAAGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
961250670 3:125502381-125502403 TTTTCTTTCTTTCTGGTAGAAGG + Intronic
965008851 3:163059699-163059721 ATTACTTTATTTAGGGTAGAAGG - Intergenic
965103574 3:164333212-164333234 CTCTCTTTCTTTTGGGTAAAAGG - Intergenic
966646155 3:182248108-182248130 CTCTCTGCCTTTAGGGTAGAGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967450595 3:189618559-189618581 CCTCTGTTCTTGAGGGTAGAGGG + Intergenic
970747519 4:19317282-19317304 CTTTCTTTCTTCTGGGTACAGGG + Intergenic
976278662 4:83304713-83304735 CTTTCCTTCTTGAAAGTAGAGGG + Intronic
981932093 4:150201203-150201225 CTTTCTTTCCTTAGAGTTGAGGG + Intronic
985726922 5:1521417-1521439 ATTTCTTTCTTTGGGGAAGAAGG + Intronic
988944240 5:36179344-36179366 CTTAAGTTCTTTAGCATAGATGG - Intronic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
991725191 5:69528824-69528846 CTTTCCTTCTTAGAGGTAGATGG + Intronic
994164767 5:96597276-96597298 CTTTTCTTTTTTAGGGCAGATGG - Intronic
994816590 5:104594042-104594064 CTTTCTTTCTTTGGATTAGAGGG + Intergenic
995130909 5:108629557-108629579 CTTTCTTTCTTTGGGGACGAGGG + Intergenic
997264425 5:132486837-132486859 CTTTCTTTCTGTGGGGCAGACGG + Exonic
1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG + Intergenic
1000971950 5:167724505-167724527 CTTTCATTCTATTGGGTGGAGGG + Intronic
1002885370 6:1289323-1289345 CTGTCCTGCTTTAGGGAAGATGG - Intergenic
1004516640 6:16327070-16327092 CTTTTGTCGTTGAGGGTAGAAGG + Exonic
1007650593 6:43418205-43418227 CTTTCTTTCTTTAGGGAAAGAGG - Intergenic
1010011925 6:71057827-71057849 GTTTCTTTCCTTTGGGTAGAGGG + Intergenic
1010644238 6:78367780-78367802 TGTGGGTTCTTTAGGGTAGAGGG + Intergenic
1016974705 6:149796024-149796046 CTTTCGTTCTTAAGAGTTGTGGG + Intronic
1018130406 6:160725499-160725521 CTTTCCTTCTTTTGGATAAATGG - Intronic
1019023227 6:168936622-168936644 CTTATCTTCTTTAGTGTAGATGG + Intergenic
1019882429 7:3874696-3874718 CTTTCATTCCTTAGGGAAGATGG + Intronic
1020733052 7:11909048-11909070 CTTTCATTCTGAAGGGGAGAAGG + Intergenic
1021481035 7:21117329-21117351 CTTTTTGTCTTTAGGGGAGAAGG - Intergenic
1022525598 7:31035101-31035123 CTTTCCTTCTTTGGGGTCGAGGG - Intergenic
1023044392 7:36198643-36198665 CTTTCGATTTTCAGGGAAGAAGG - Intronic
1037392029 8:18403301-18403323 CTTCCGTTCTTTGAGCTAGAAGG + Intergenic
1040387592 8:46924075-46924097 CTCTCCTCCTTTAGGGAAGATGG - Intergenic
1042676449 8:71327138-71327160 CTTTCATTCTTTGGGAGAGACGG - Intronic
1045046681 8:98285554-98285576 CTTTTGTTCTTCAGGGTTGTTGG - Intronic
1045379687 8:101610950-101610972 CTTTCGATATTAAGGGCAGAAGG + Intronic
1046707811 8:117475825-117475847 GCTTCTTTCTTTATGGTAGAAGG + Intergenic
1047706409 8:127504111-127504133 CTTTGATGATTTAGGGTAGACGG - Intergenic
1049390684 8:142368760-142368782 CTTTTATTCTTCAGGGGAGAGGG - Intronic
1057237781 9:93378945-93378967 GTTTGTTTCATTAGGGTAGATGG - Intergenic
1060715098 9:125918845-125918867 TTTCAGTTCTTTAGGGTACAAGG + Intronic
1061079118 9:128359618-128359640 CTTTCTTTCTTTATTGGAGACGG - Intronic
1186398930 X:9238780-9238802 CTTTTCTGCTTTTGGGTAGAGGG + Intergenic
1187053635 X:15718820-15718842 CTTACCTACTTGAGGGTAGAGGG + Intronic
1187465735 X:19526058-19526080 CTTTTGTTCCTTAAGGGAGAAGG + Intergenic
1188692189 X:33143561-33143583 ATTCCCTTATTTAGGGTAGAGGG + Intronic
1189698353 X:43689384-43689406 CTTTCCTTCTTTTGGGTTAATGG + Intronic
1193923124 X:87453945-87453967 CTTTCCTTTTTGAGGGGAGATGG - Intergenic
1201973637 Y:19822257-19822279 CTTTTGTACTTTAGTGGAGATGG - Intergenic