ID: 924211954

View in Genome Browser
Species Human (GRCh38)
Location 1:241778185-241778207
Sequence AGGGACATACACATTAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924211950_924211954 4 Left 924211950 1:241778158-241778180 CCTATAAGTATTTTGATATCTGT 0: 1
1: 0
2: 2
3: 36
4: 392
Right 924211954 1:241778185-241778207 AGGGACATACACATTAAGGATGG 0: 1
1: 0
2: 1
3: 26
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924211954 Original CRISPR AGGGACATACACATTAAGGA TGG Intronic
900234414 1:1580620-1580642 AGGGACACAAACACTGAGGAAGG + Intergenic
901894967 1:12303944-12303966 AAGGACATACAAATTAAGAAGGG - Intronic
902137857 1:14326288-14326310 AGGAACAGACACAACAAGGATGG - Intergenic
902139368 1:14339677-14339699 AGCCCCATTCACATTAAGGAGGG + Intergenic
905360781 1:37418842-37418864 AGGGACATACACACTGGAGAAGG - Intergenic
907658060 1:56365120-56365142 AGGCCCATTCACATTAAGGAGGG + Intergenic
908640380 1:66216284-66216306 AGGCCCATGCACATTGAGGAGGG - Intronic
909042737 1:70673541-70673563 AGGCCCATTCACATTATGGAGGG - Intergenic
909696121 1:78469758-78469780 AGGGCCACCCACATTATGGAGGG + Intronic
910815595 1:91288527-91288549 AGGGACACAAACACTAGGGAAGG - Intronic
911910134 1:103623715-103623737 AGGGCTATAAACATTAATGAAGG + Intronic
911917554 1:103717840-103717862 AGGGCTATAAACATTAATGAAGG + Intronic
913263540 1:117022918-117022940 AGGAACACACACATTTAGCAGGG - Intronic
915035242 1:152918113-152918135 AGGCCCATACATATTATGGAGGG + Intergenic
916324848 1:163545655-163545677 AGGGACATAAACACTGCGGAAGG - Intergenic
918706821 1:187673431-187673453 AGGTGCATCCACATTATGGAGGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920387869 1:205580911-205580933 AGGGACACTCACATTGATGAGGG - Exonic
921109207 1:212015553-212015575 AGGGACACAAACACTGAGGAAGG + Intronic
922043547 1:221920917-221920939 AGGGATATACAAAGAAAGGAAGG + Intergenic
922458350 1:225795741-225795763 AGGGACACAAACACTACGGAAGG - Intergenic
923027805 1:230219778-230219800 AGGGACACACCCATTTAGAAAGG - Intronic
923266277 1:232317619-232317641 AGGTCCATCCACATTATGGAGGG - Intergenic
923268251 1:232332933-232332955 AGGGACATAAACACTGTGGAAGG + Intergenic
924211954 1:241778185-241778207 AGGGACATACACATTAAGGATGG + Intronic
924721185 1:246624652-246624674 AGGGACACACAAATCAGGGAGGG + Intronic
924745257 1:246827020-246827042 AGGTACATACCCATTCAGGCTGG + Intergenic
1063832749 10:9974368-9974390 AGGGACTTACACAATGATGAAGG + Intergenic
1066046145 10:31597194-31597216 AGGGCCACCCACATTAGGGAGGG + Intergenic
1066258067 10:33700836-33700858 AGATACATACACAATAAAGAAGG + Intergenic
1066501771 10:36001858-36001880 AGGCCCATTCACATTATGGAAGG - Intergenic
1066551141 10:36558658-36558680 AAGTACATACACTTTAATGAAGG - Intergenic
1067473680 10:46552938-46552960 ATGGACATACAAACAAAGGAGGG + Intronic
1067658515 10:48215959-48215981 AGGTACATTCACTTTAGGGAGGG - Intronic
1067989895 10:51200014-51200036 AGGGACATACAAAAGAAAGAAGG + Intronic
1068967512 10:62928415-62928437 AGGGACACAAACACTATGGAAGG - Intergenic
1069067550 10:63959503-63959525 AGGGTCATACAGATTCAGAAGGG + Intergenic
1069208834 10:65730432-65730454 AGGCTCACTCACATTAAGGAGGG + Intergenic
1069489182 10:68846876-68846898 GGTGACATACAAATTAATGAAGG + Intronic
1070523184 10:77272312-77272334 AGGAACCTATACTTTAAGGAGGG - Intronic
1071037789 10:81267767-81267789 AGAAACATACACAACAAGGAAGG - Intergenic
1071705099 10:87989388-87989410 AGGCACATCCACATTATGGTAGG + Intergenic
1071848108 10:89540497-89540519 ATGGAGATATACATTAAGAAAGG - Intronic
1073596503 10:104805665-104805687 AGGGACATCCAGAGTAGGGAAGG + Intronic
1073982326 10:109168812-109168834 AGGCCCACACACATTATGGAGGG - Intergenic
1074771650 10:116738873-116738895 AGGGACATACACAGAAGGCATGG + Intronic
1077479349 11:2806371-2806393 AAGGACAGACAAATTACGGAGGG - Intronic
1077839810 11:5961594-5961616 AGGGACACAAACACTGAGGAAGG + Intergenic
1078583723 11:12561521-12561543 AGCTACATATACATTAAGAAAGG + Intergenic
1078791876 11:14551639-14551661 AGGGACATTCACATCATGGTAGG - Intronic
1079688121 11:23387630-23387652 AGGGAAAGACACATTAATGAAGG + Intergenic
1080347576 11:31342091-31342113 AGGGTCATTCTCATTAGGGAGGG + Intronic
1080396634 11:31895873-31895895 AGGCACAAAAAAATTAAGGAAGG - Intronic
1082148954 11:48707902-48707924 AGGGACACAAACATTGTGGAAGG + Intergenic
1082964074 11:58947847-58947869 AGAGCCATACACCTGAAGGAGGG - Exonic
1082967241 11:58979305-58979327 AGAGCCATACACCTGAAGGAGGG - Intronic
1082973020 11:59043489-59043511 AGAGCCATACACCTGAAGGAGGG - Intronic
1082977417 11:59087053-59087075 AGAGCCATACACCTGAAGGAGGG - Intergenic
1084412300 11:69011935-69011957 AGGGACACCCACATAATGGAGGG - Intronic
1084988079 11:72895251-72895273 AGGAATATACCCATTAAGGCTGG + Intronic
1085928413 11:81051662-81051684 AGGGACAAAGACATTGGGGAAGG - Intergenic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1088076810 11:105859927-105859949 ATGAACATATATATTAAGGAAGG + Intronic
1091101524 11:132878362-132878384 AGGCCCATCCACATTAGGGAGGG - Intronic
1092923419 12:13252535-13252557 AGGCCCACCCACATTAAGGAGGG + Intergenic
1094520323 12:31180391-31180413 AGGGACACAAACACTAAGGAAGG - Intergenic
1095280974 12:40352609-40352631 AGGGACACAAACACTACGGAAGG - Intronic
1096064112 12:48725412-48725434 AGGGACACAAACACTGAGGAAGG + Intergenic
1098242691 12:68484763-68484785 AGGGACACAAACATTGCGGAAGG + Intergenic
1100578372 12:95914472-95914494 AGTGACGGAGACATTAAGGAGGG - Intronic
1100606878 12:96158748-96158770 AGGGACATAAACACTGCGGAAGG + Intergenic
1101114531 12:101519024-101519046 AGGCCCATACACATTAGGGAGGG - Intergenic
1102603676 12:114052567-114052589 AGGAAAATACACAATAAGGTAGG + Intergenic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1104072780 12:125360893-125360915 AGTCACATAGACAGTAAGGAGGG - Intronic
1106957441 13:34955827-34955849 AGGCCCATCCACATTAGGGAGGG + Intronic
1107562817 13:41572640-41572662 AGGGACACAAACACTGAGGAAGG + Intronic
1107847208 13:44527999-44528021 AGGCACATACATATTAAGAATGG - Intronic
1108351695 13:49594070-49594092 AGGGACACAAACATTGCGGAAGG + Intergenic
1109392613 13:61711805-61711827 AGGCCCATTCACATTATGGAGGG - Intergenic
1110370675 13:74736902-74736924 ATGCACATACAGATTAAGAATGG - Intergenic
1111226167 13:85273964-85273986 AAGGACATATACATCAAGGGTGG - Intergenic
1112351305 13:98636862-98636884 AAGCACATACACATTAGGAAGGG - Intergenic
1112619267 13:101038015-101038037 AGGGCCACTCACATTATGGACGG - Intergenic
1113478814 13:110605806-110605828 AGGGACACAAACACTGAGGAAGG - Intergenic
1114594172 14:23897843-23897865 AGGGACACAAACACTGAGGAAGG - Intergenic
1114977249 14:28117182-28117204 AAGAAAATACACATTAAAGAGGG - Intergenic
1116587913 14:46733593-46733615 AGGTACATAAAGATTAAGGAAGG - Intergenic
1117497795 14:56323088-56323110 ATGGACACGCACATTATGGACGG + Intergenic
1118253134 14:64182537-64182559 AGGGACACAAACACTGAGGAAGG - Intronic
1118473750 14:66098669-66098691 GGGGACATACACAGGAAGAAAGG + Intergenic
1118498426 14:66332288-66332310 AGGGCCACCCACATTACGGAAGG + Intergenic
1119051708 14:71376713-71376735 AGGGACACAAACACTAAGGAAGG - Intronic
1119662707 14:76463024-76463046 AAGGACAGACACATTAAGTCCGG + Intronic
1120911251 14:89669022-89669044 AGGCCCATCCACATTATGGAAGG + Intergenic
1121519577 14:94576892-94576914 AGGAGGAGACACATTAAGGAAGG - Intronic
1124199494 15:27666139-27666161 AGGCCCATCCACATTACGGAAGG - Intergenic
1124428194 15:29581403-29581425 AGGGCCACCCACATTATGGAGGG + Intergenic
1125478059 15:40060989-40061011 AGGGACAACCACTTCAAGGAGGG + Intergenic
1126573352 15:50173540-50173562 AGGGACATAAACACTGCGGAAGG + Intronic
1126785709 15:52176498-52176520 AGGGACAAACACACTTAGGAAGG + Intronic
1126799582 15:52286787-52286809 AGGGACACAAACACTGAGGAAGG + Intronic
1127154696 15:56111494-56111516 AGGGACACAAACACTGAGGAAGG + Intronic
1127827379 15:62716718-62716740 AAGGATATACACATTCAAGAAGG + Intronic
1128500364 15:68222972-68222994 AGGGACATAAACACTGAGGAAGG + Intronic
1128871675 15:71162645-71162667 ACAGACATCCACATTCAGGAAGG - Intronic
1131943468 15:97593127-97593149 AGAGACATAAACACTAAGGAGGG - Intergenic
1132356661 15:101176068-101176090 AGGAATATAAAAATTAAGGAGGG + Exonic
1135909143 16:26543344-26543366 AGTGACAGACACATTAAAAAAGG - Intergenic
1138043734 16:53699236-53699258 AGGGACACAAACACTGAGGAAGG + Intronic
1139051218 16:63127002-63127024 AGGCTCATAAACATTTAGGATGG - Intergenic
1140994558 16:80244655-80244677 AGGGACACAAACACTGAGGAAGG + Intergenic
1144058646 17:11562107-11562129 AGTGACATACACAAGCAGGAAGG - Exonic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1145295686 17:21591006-21591028 AGGGACACAAACACTGAGGAAGG + Intergenic
1147052117 17:37803067-37803089 TGTGACATGCACATTGAGGAGGG + Intergenic
1148001556 17:44390520-44390542 ATGGAAACACACACTAAGGATGG + Intergenic
1148073932 17:44924696-44924718 AGAGACACACACACCAAGGATGG + Intronic
1150056340 17:62020836-62020858 AGGGACACAAACACTGAGGAAGG - Intronic
1150464644 17:65381791-65381813 AGGGAATTACATATTAAAGAAGG - Intergenic
1150962339 17:69928090-69928112 AGGCCCATTCACATTAGGGAGGG - Intergenic
1151733181 17:75922962-75922984 AGGGACATACCCAAGAAGGAGGG - Intronic
1153326867 18:3829722-3829744 AGGCCCATCCACATTATGGAGGG + Intronic
1154282959 18:13024175-13024197 AGGTGTATACACGTTAAGGATGG + Intronic
1154482931 18:14855054-14855076 AGGGACACAAACACTATGGAAGG - Intergenic
1154956379 18:21260372-21260394 AAGAAGATACATATTAAGGAGGG + Intronic
1155518397 18:26645026-26645048 TGGAACATACACGTTAGGGAAGG - Intronic
1159106215 18:64003816-64003838 GGGGCCACCCACATTAAGGAGGG + Intronic
1159484949 18:69043520-69043542 AGGGACACAAACACTGAGGAAGG - Intronic
1160349467 18:78163069-78163091 AGGCACATACATATTTAGGATGG + Intergenic
1161027974 19:2045437-2045459 AGGGACAGACACAGTACGGACGG - Intronic
1161386872 19:3999292-3999314 AGGGACATAAACACTGCGGAAGG + Intergenic
1164765720 19:30765962-30765984 TTGCACATACACATTAAGAATGG + Intergenic
1168455070 19:56500433-56500455 AAGGACTTAGACATTAAGGGTGG - Intergenic
1168642054 19:58037373-58037395 AGGGAGATAGACACTAAGTAAGG + Intronic
927740011 2:25560395-25560417 AGGGTCATCCACACTAGGGAAGG - Intronic
928646924 2:33364551-33364573 CTGGACATACTCATTAAGTATGG + Intronic
928653256 2:33423693-33423715 ACGGACATACACAGAAAAGAAGG - Intergenic
929208081 2:39321438-39321460 AGGGACACAAACACTACGGAAGG + Intronic
929348675 2:40919958-40919980 AGGTACATAAATACTAAGGAGGG + Intergenic
931105769 2:59053573-59053595 AGGGATATCCACTTAAAGGAGGG + Intergenic
931829834 2:66039220-66039242 AGGCCCATCCACATTATGGAGGG + Intergenic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
935561438 2:104563860-104563882 AGGGCCACCCACATTACGGATGG + Intergenic
935734781 2:106097801-106097823 AGGAACACACAGATTCAGGATGG + Intronic
937090140 2:119200811-119200833 AGGGACATTCACAGTCTGGATGG - Intergenic
937791275 2:125964933-125964955 AGGGAAATGCAGATGAAGGAGGG + Intergenic
938153828 2:128910656-128910678 AGGGACATGCCCAATAGGGACGG - Intergenic
938534355 2:132222682-132222704 AGGGACACAAACATTGCGGAAGG + Intronic
938807856 2:134823423-134823445 AGGCTCATCCACATTATGGAGGG + Intergenic
938971255 2:136435029-136435051 AAGGAGAGACAAATTAAGGATGG - Intergenic
939825747 2:147013477-147013499 ATGAACATACACATTAATAAAGG + Intergenic
939845413 2:147239349-147239371 AGGTACATACACATTTAAGATGG + Intergenic
939985426 2:148825363-148825385 AGGCCCATCCACATTAAGGAGGG - Intergenic
940820286 2:158346422-158346444 AGGGACATACAGAAGAAGCAAGG - Intronic
941636040 2:167935854-167935876 AGGCCCATCCACATTAGGGAGGG - Intergenic
941637052 2:167946075-167946097 AGGAACAGACACTTTAAGGGAGG - Intergenic
942405531 2:175650005-175650027 AGGTGCATATACATTTAGGATGG - Intergenic
943791595 2:191938939-191938961 AAGGACATTCACTTTCAGGAAGG - Intergenic
1169723623 20:8705026-8705048 AGGCCCATCCACATTAGGGAGGG + Intronic
1169885488 20:10394451-10394473 AGGGACATAAACACTGCGGAAGG - Intergenic
1171318961 20:24221682-24221704 AGGGTCAAACACATTAAGATTGG - Intergenic
1172819212 20:37717755-37717777 AGGGACACAAACACTACGGAAGG - Intronic
1173008895 20:39163380-39163402 AAAGCCATACACATTAGGGAGGG + Intergenic
1176797671 21:13381523-13381545 AGGGACACAAACACTATGGAAGG + Intergenic
1177290035 21:19098896-19098918 AGGCCCATTCACATTATGGAGGG + Intergenic
1177731203 21:25028687-25028709 AGGCCCATCCACATTATGGAGGG - Intergenic
1177887146 21:26760998-26761020 AGGCACACCCACATTAAGGAAGG - Intergenic
1178151708 21:29802267-29802289 AGAGACATAAAGAGTAAGGAAGG - Intronic
1178293154 21:31386715-31386737 AGGTACATACATCTTAGGGAGGG + Intronic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178473064 21:32911928-32911950 AGGCTCATTCACATTAAGGAAGG + Intergenic
1178735607 21:35147199-35147221 AGGGAGAAAGATATTAAGGATGG - Intronic
1179263366 21:39778482-39778504 TGCAACATACACACTAAGGAAGG + Intronic
1179416982 21:41206598-41206620 AGAGACAGAAACATTAAGGGTGG + Intronic
1180748276 22:18107249-18107271 AGGCCCCTGCACATTAAGGAGGG + Intronic
1181678289 22:24472295-24472317 AGGGACCTACACATTAACAGAGG - Intergenic
1181950797 22:26552227-26552249 AGGGACATACACACAAACTAAGG + Intronic
1182399052 22:30060299-30060321 AGGGACACAAACACTGAGGAAGG + Intergenic
1182399935 22:30067355-30067377 AGGGACACAAACACTGAGGAAGG + Intergenic
1184201502 22:42972352-42972374 AGGGACATAAACATTGCGGAAGG + Intronic
1184841864 22:47056862-47056884 AGGGACAGACACAGAATGGAAGG + Intronic
949636967 3:5993350-5993372 AGGCCCACACACATTATGGAGGG + Intergenic
949989977 3:9570581-9570603 AGGGACACAAACACTGAGGAAGG + Intergenic
952426696 3:33182607-33182629 AGGCACATATACATTAAAGATGG + Intronic
952591834 3:34964522-34964544 AGAGACATACATATAAAAGAAGG - Intergenic
953440057 3:42909213-42909235 AGGGACACAAACACTACGGAAGG - Intronic
954164567 3:48745884-48745906 AGGCCCACACACATTAGGGAAGG - Intronic
954188125 3:48935844-48935866 AGGAGCCTACACATTGAGGATGG + Intronic
955245084 3:57217681-57217703 AGGGAAGTACCCATAAAGGAGGG - Intronic
958185965 3:90119399-90119421 AAGCAAATACACATTAAGTAAGG - Intergenic
959192786 3:103136810-103136832 AGCTTCTTACACATTAAGGAAGG + Intergenic
959412537 3:106043151-106043173 AGGCCCATACACATTCAGGGGGG - Intergenic
961092788 3:124129458-124129480 AGAGACATACTCTTTAAGGGTGG + Intronic
962572478 3:136724450-136724472 AGGGACACAAACACTGAGGAAGG + Intronic
963650851 3:147978161-147978183 AGGGACATCAACATGAGGGAGGG - Intergenic
963770449 3:149381246-149381268 AGGGACACAAACACTACGGAAGG + Intergenic
964148899 3:153500069-153500091 AGGCACGTTCACATTAAGGAGGG - Intronic
965379053 3:167965639-167965661 AGGCCCACACACATTGAGGATGG - Intergenic
966306683 3:178543979-178544001 AGAGACTTACAGTTTAAGGAGGG - Intronic
966495291 3:180573340-180573362 AGGTACACTCACATTATGGAGGG - Intergenic
967198286 3:187048599-187048621 ACGGACATAGACAGTAAAGACGG - Intronic
969066361 4:4484886-4484908 TGGGCCAGGCACATTAAGGACGG + Intronic
970440417 4:16076934-16076956 AGGGACACAAACATTGCGGAAGG + Intronic
970639942 4:18052646-18052668 AATGACATAGACGTTAAGGAAGG + Intergenic
971721682 4:30253386-30253408 AGGGGCATATATATTTAGGATGG + Intergenic
973051172 4:45599581-45599603 AGGTCCATCCACATTATGGAGGG + Intergenic
973263534 4:48187277-48187299 AGGGACACAAACATTGCGGAAGG + Intronic
974152996 4:58033933-58033955 AGGCCCACACACATTATGGAGGG + Intergenic
974225409 4:59036606-59036628 AGGGATATAAAAATTAAAGATGG - Intergenic
977368993 4:96110748-96110770 AGGCCCATTCACATCAAGGAGGG + Intergenic
977415454 4:96727195-96727217 AGGCCCATACACATTGAGGAGGG - Intergenic
977893969 4:102344398-102344420 AGGGACACCCACAGTACGGAGGG + Intronic
979608704 4:122667865-122667887 AGGCACATCCACATTATTGAGGG + Intergenic
980072278 4:128256236-128256258 AGGCCCATCCACATTATGGAGGG + Intergenic
980883784 4:138739977-138739999 AGGGACACAAACACTGAGGAAGG + Intergenic
980983856 4:139676569-139676591 AGGCCCACCCACATTAAGGAGGG + Intronic
981697687 4:147575290-147575312 AGGGTCACTCACATTAGGGAGGG - Intergenic
983857225 4:172661157-172661179 AGGCCCATCCACATTATGGAGGG - Intronic
984746018 4:183218821-183218843 AGGTATATTCACATTATGGAGGG + Intronic
984813598 4:183818244-183818266 AGGGACACAAACACTGAGGAAGG - Intergenic
986130466 5:4925206-4925228 AGGGACATAAACACTGCGGAAGG + Intergenic
986759272 5:10865048-10865070 ACTGATATACACATTAAGCAAGG - Intergenic
987125931 5:14812698-14812720 AAGGACATAGACATCAAGGGTGG - Intronic
987198981 5:15555517-15555539 AGGGACATACACCTTCAGCCAGG - Intronic
987673970 5:21050733-21050755 AGGCACGTTCACATTAGGGAAGG - Intergenic
987746641 5:21982136-21982158 AGGCCCATCCACATTAGGGAAGG - Intronic
989635022 5:43522915-43522937 AGGGACACAAACATTGCGGAAGG + Intergenic
990835598 5:60015678-60015700 AGGCCCATCCACATTATGGAGGG - Intronic
991232303 5:64349241-64349263 ATAGACATAAACATTAATGAGGG + Intronic
991446262 5:66703118-66703140 AGGAACACACTCATGAAGGATGG - Intronic
991766814 5:69991894-69991916 AGGCCCATCCACATTAGGGAAGG - Intergenic
991846046 5:70866968-70866990 AGGCCCATCCACATTAGGGAAGG - Intergenic
993940826 5:94056935-94056957 AGGCTCATACAAATTGAGGAGGG - Intronic
994139554 5:96326574-96326596 AGGTACGTACAAATTAAAGAGGG - Intergenic
996057758 5:118999542-118999564 AGGGACACAAACACTGAGGAAGG + Intergenic
996266172 5:121543354-121543376 AGGAACAGAAATATTAAGGATGG + Intergenic
997270055 5:132528922-132528944 AGCATCATACACATTTAGGAGGG - Intergenic
997835257 5:137186960-137186982 AGGGAGTAACACATTCAGGAGGG - Intronic
998848207 5:146331321-146331343 AGGGACGAACAAGTTAAGGAAGG - Intronic
1000480806 5:161771484-161771506 AGGCACATACAAATCAAAGAAGG + Intergenic
1000782705 5:165503143-165503165 AGAGACAGACACATTAAAAAAGG + Intergenic
1003721747 6:8710868-8710890 AGGCCCACCCACATTAAGGAGGG + Intergenic
1004476021 6:15973063-15973085 AGGGCCACCCACATTAGGGAGGG - Intergenic
1004576229 6:16897853-16897875 AGGCCCACCCACATTAAGGAGGG - Intergenic
1006480357 6:34287993-34288015 AGGGAAATACAGCTTAAAGAAGG + Exonic
1006628723 6:35416012-35416034 AGGGCCACTCACATTATGGAGGG + Intronic
1008474862 6:51925535-51925557 AGGCTCATCTACATTAAGGAAGG - Intronic
1008646908 6:53523678-53523700 AGGGAAATACACATAAATAAGGG - Intronic
1009042133 6:58191279-58191301 AGGGACACAAACATTGCGGAAGG + Intergenic
1009217969 6:60945511-60945533 AGGGACACAAACATTGCGGAAGG + Intergenic
1010534103 6:77004337-77004359 AGGCCCATGCACATTATGGAGGG - Intergenic
1010922714 6:81703911-81703933 AGGGTCATCCACATTTAGGAGGG - Intronic
1011070983 6:83382954-83382976 AGGCCCATACACATTGTGGAAGG - Intronic
1016003351 6:139065232-139065254 AAGCCCATACACATTACGGAGGG + Intergenic
1017462485 6:154664556-154664578 AGGGCCATACACATAAAAGTGGG + Intergenic
1018771257 6:166973275-166973297 AGGCACAAACAAAATAAGGAAGG + Intergenic
1020104965 7:5418574-5418596 AGGGAGAGGCACATTAAGGTTGG - Intronic
1020673336 7:11147739-11147761 AGGGACATACAAATAGAGAAGGG - Intronic
1022275260 7:28848359-28848381 TGGGACATATGCACTAAGGAGGG - Intergenic
1022354966 7:29605975-29605997 AGGTACAGCCACATTATGGATGG + Intergenic
1022886863 7:34655523-34655545 AGAGCCATTCACATTAGGGAGGG + Intergenic
1023601345 7:41884562-41884584 AGGGCCAATCACATTACGGAGGG - Intergenic
1026411641 7:70128967-70128989 AAGGTCATACAGATTTAGGATGG - Intronic
1028034542 7:85964681-85964703 AGTGGCATCCACATTCAGGAAGG + Intergenic
1028331455 7:89599792-89599814 AGGTAAATACATATTAAAGATGG - Intergenic
1028360756 7:89963880-89963902 AGGGCCACCCACATTAAGGAGGG + Intergenic
1031250668 7:119376233-119376255 AGGCCCAAACACATTAAGGAGGG + Intergenic
1031274458 7:119701643-119701665 AGGGAGACACATATGAAGGAAGG - Intergenic
1032570053 7:132986250-132986272 AGGGACATAAACACTGCGGAAGG + Intronic
1036072157 8:5453145-5453167 AGGGCCACTCACATTATGGAGGG - Intergenic
1036602286 8:10272509-10272531 AGGACCATCCACATCAAGGAGGG + Intronic
1038471932 8:27831375-27831397 AGGTACATACACATTTAGGATGG - Intronic
1038839244 8:31164711-31164733 AGTTACATGCACATTAAGAATGG - Intronic
1040293828 8:46139052-46139074 AGGGACTCAGACATTGAGGAAGG - Intergenic
1040533200 8:48282634-48282656 AGGGACAGAGACAGTGAGGAGGG + Intergenic
1040616156 8:49041042-49041064 AGGGACACAAACACTACGGAAGG - Intergenic
1041005901 8:53496793-53496815 AGGGACTTGCACATGAAAGAAGG + Intergenic
1041422596 8:57685224-57685246 AGGCCCACACACATTAGGGAGGG - Intergenic
1042363165 8:67905721-67905743 AAGGCCACACACATTAGGGAAGG - Intergenic
1042912981 8:73845553-73845575 AGGGACACAAACATTGCGGAAGG + Intronic
1043117277 8:76274009-76274031 AGGCCCATCCACATTAGGGAGGG - Intergenic
1043485686 8:80697093-80697115 TGGGAGAAACACATCAAGGAAGG + Intronic
1043626309 8:82264193-82264215 ACGTGCTTACACATTAAGGATGG + Intergenic
1044784324 8:95778540-95778562 TGGGACATACAGATTGAGAAAGG - Intergenic
1045160539 8:99537848-99537870 ATGACCCTACACATTAAGGAAGG - Intronic
1046527654 8:115401850-115401872 TGGGACGGAAACATTAAGGACGG + Intergenic
1047284116 8:123471760-123471782 AGGGCCACCCACATTAGGGAGGG + Intergenic
1048530074 8:135239969-135239991 AGGGACAAAGAAATCAAGGAAGG - Intergenic
1048807708 8:138255868-138255890 AGGGTCAGGCACAGTAAGGAGGG - Intronic
1051344180 9:16137713-16137735 TGGGAGATACACACAAAGGAAGG - Intergenic
1052780316 9:32776313-32776335 AGGGCCATTCACATTATGGAGGG - Intergenic
1055518769 9:77060301-77060323 AGGGACACAAACATTGCGGAAGG - Intergenic
1055739694 9:79373402-79373424 AGGGCCACACACATTGGGGAGGG + Intergenic
1058390335 9:104489366-104489388 AGGGACACAAACACTACGGAAGG - Intergenic
1058650516 9:107171635-107171657 AGGTCCATCCACATTAGGGAGGG + Intergenic
1059598097 9:115744860-115744882 AGGCCCATTCACATTAGGGAGGG - Intergenic
1059920860 9:119158330-119158352 AGACACATACACAATAGGGAAGG + Intronic
1060416022 9:123431367-123431389 AGGCCCAGAAACATTAAGGAGGG + Intronic
1060569536 9:124625782-124625804 AGGCACACTCACATTATGGAGGG - Intronic
1060746632 9:126139135-126139157 AGGGCCACCCACATTAGGGAGGG - Intergenic
1203562793 Un_KI270744v1:72240-72262 AGGGACACAAACATTGCGGAAGG + Intergenic
1187382746 X:18820224-18820246 AAGTACATACACATTTAGAATGG - Intronic
1188942771 X:36261474-36261496 AGGGACACAAACACTGAGGAAGG - Intronic
1188985640 X:36766247-36766269 AGGGACATGCAGAATAAGGGAGG - Intergenic
1189685874 X:43563077-43563099 AGGCACACTCACATTATGGAGGG - Intergenic
1189918945 X:45884627-45884649 AGGGCCACCCACATTAGGGAGGG - Intergenic
1190642552 X:52494926-52494948 AGGGACATGCACATTGAGCCAGG - Intergenic
1190645121 X:52517941-52517963 AGGGACATGCACATTGAGCCAGG + Intronic
1190998633 X:55636845-55636867 AGGGACATGCACATTGAGCCAGG + Intergenic
1193132116 X:77931161-77931183 AGGGACACAAACACTGAGGAAGG - Intronic
1193935834 X:87619989-87620011 AGGCCCATTCACATTAGGGAAGG - Intronic
1198845887 X:140910039-140910061 AGGCCCATCCACATTATGGAGGG - Intergenic
1199365264 X:146972823-146972845 AGGCCCACACACATTAGGGAAGG + Intergenic
1201259195 Y:12141295-12141317 AAGAAAATACAGATTAAGGATGG + Intergenic