ID: 924213403

View in Genome Browser
Species Human (GRCh38)
Location 1:241793840-241793862
Sequence CATGTTATGAGACATGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924213403_924213406 26 Left 924213403 1:241793840-241793862 CCTGCTTCATGTCTCATAACATG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 924213406 1:241793889-241793911 TAGAATTATTCAGCTGGGTGTGG 0: 1
1: 0
2: 6
3: 91
4: 1032
924213403_924213405 21 Left 924213403 1:241793840-241793862 CCTGCTTCATGTCTCATAACATG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 924213405 1:241793884-241793906 TAAAATAGAATTATTCAGCTGGG 0: 1
1: 0
2: 1
3: 56
4: 743
924213403_924213407 29 Left 924213403 1:241793840-241793862 CCTGCTTCATGTCTCATAACATG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 924213407 1:241793892-241793914 AATTATTCAGCTGGGTGTGGTGG 0: 1
1: 10
2: 144
3: 1581
4: 17430
924213403_924213404 20 Left 924213403 1:241793840-241793862 CCTGCTTCATGTCTCATAACATG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 924213404 1:241793883-241793905 TTAAAATAGAATTATTCAGCTGG 0: 1
1: 0
2: 4
3: 45
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924213403 Original CRISPR CATGTTATGAGACATGAAGC AGG (reversed) Intronic
901727629 1:11254440-11254462 CTTATTATGAGAATTGAAGCTGG - Intronic
904417069 1:30369568-30369590 CGTGTTCAGAGACATGCAGCTGG + Intergenic
905703223 1:40035066-40035088 CTGGCTATGAGACAGGAAGCAGG + Intergenic
907826824 1:58025843-58025865 AATGTGATGAGAGATGAGGCTGG - Intronic
907933792 1:59023911-59023933 CAAATTATGAGACATAAATCAGG + Intergenic
908884774 1:68776000-68776022 CATGTTATTAAACATCGAGCAGG - Intergenic
909692450 1:78423922-78423944 CATTTTATAAAACAGGAAGCAGG + Intronic
910377436 1:86587794-86587816 GAAGTTGTGAGACATGAAACTGG - Intergenic
915470473 1:156122943-156122965 CAAGTTGTGAGAGAGGAAGCCGG + Intronic
918203745 1:182291063-182291085 CATGAAATGAGACAAGAACCAGG + Intergenic
919236014 1:194843534-194843556 CATGTTCTGAAAAATTAAGCAGG + Intergenic
919562156 1:199135206-199135228 CAAGTTATTAGAGATGAGGCAGG - Intergenic
920208442 1:204310781-204310803 CTAGTTCTGAGACATGCAGCAGG + Intronic
922439316 1:225639547-225639569 CATGTTATGAGACAGCAAGAAGG + Intronic
923762440 1:236859179-236859201 CATGTTATGACACAGCAAGAAGG - Intronic
924213403 1:241793840-241793862 CATGTTATGAGACATGAAGCAGG - Intronic
1063343710 10:5292611-5292633 CGTGTGGTGAGACAGGAAGCAGG - Intergenic
1064419051 10:15174567-15174589 CATGTTAAGTGAAATAAAGCAGG - Intergenic
1066313752 10:34223077-34223099 CAGGTTCTGAGAGATGAAGCTGG + Intronic
1071487660 10:86113505-86113527 CATGTAATGAGACATGACTGGGG - Intronic
1071660842 10:87501200-87501222 CAGGTAATAAGAGATGAAGCTGG + Intergenic
1073763962 10:106661873-106661895 CATGTCATTTGACATGAAGGTGG - Intronic
1073918580 10:108433210-108433232 CATGTTCAGTGAAATGAAGCTGG - Intergenic
1075756847 10:124819020-124819042 CATTTTCTGAGAAATGAAGAAGG - Intronic
1075825369 10:125352771-125352793 CATGTTATGACACAGCAAGAAGG - Intergenic
1077446967 11:2599701-2599723 CATGTGATGACACAGGAAGAAGG - Intronic
1078385667 11:10890053-10890075 AATGTTATGAGACGTCAAGTAGG + Intergenic
1078555856 11:12325599-12325621 CATGTGAGGACACATGAAGAAGG - Intronic
1078881471 11:15453325-15453347 CATATTTAGAGACATGAACCAGG + Intergenic
1079592831 11:22201654-22201676 CATGTTATGACACAGCAAGAAGG - Intronic
1080176272 11:29366624-29366646 CTGGTTATGAGACCTGCAGCAGG - Intergenic
1080492694 11:32783571-32783593 CATGTGAGGACACAGGAAGCAGG - Intronic
1080580445 11:33638010-33638032 CATGTTTTCAGACCTGAAGGAGG - Intronic
1080791163 11:35523991-35524013 CATGTAATAAAACAGGAAGCAGG + Intronic
1081792062 11:45795240-45795262 TTTGTGATGAGACATGAAGGAGG - Intergenic
1083689535 11:64398741-64398763 CATGTTATGACACAGCAAGAAGG + Intergenic
1087221341 11:95549689-95549711 CATTTTATGAGACGAGAAGACGG - Intergenic
1089573452 11:119424634-119424656 CATTTTATGAAAAATGCAGCTGG + Intronic
1089748278 11:120632204-120632226 CATGTGAAGATACAAGAAGCTGG + Intronic
1090250294 11:125246226-125246248 CATGTTATGACACAGCAAGAAGG - Intronic
1092959775 12:13585223-13585245 CATCTTCAGAGTCATGAAGCTGG + Intronic
1093293313 12:17356211-17356233 CATGTTGTAAAACAAGAAGCTGG - Intergenic
1094600082 12:31901068-31901090 CATGTTATGACACAGCAAGAAGG + Intergenic
1094731128 12:33177073-33177095 AATGTCATGAGACAGGAAGCAGG - Intergenic
1095373486 12:41498456-41498478 CATGTTATGACACAGAAAGAAGG - Intronic
1095532398 12:43203673-43203695 AAAATTATGAGACATAAAGCAGG + Intergenic
1097370481 12:58773226-58773248 CATGTTATAACACAGCAAGCAGG + Intronic
1097714100 12:62947255-62947277 CCTGTTATGACACAGGAAGAAGG - Intergenic
1097909498 12:64954408-64954430 CATGTTATGACACAGTAAGAAGG + Intergenic
1098708765 12:73726698-73726720 CATGTTATAAAACATAAAGCAGG - Intergenic
1100818688 12:98410519-98410541 CATGTTATGACACAGCAAGAAGG + Intergenic
1101751222 12:107584147-107584169 CATTTAATGTGACATGAAGTAGG + Intronic
1102186856 12:110955769-110955791 AATGTGATGAGACATGTAGAGGG - Intergenic
1103130990 12:118468525-118468547 CATGTTATGAGGCAACAAGAAGG - Intergenic
1103895908 12:124272993-124273015 CATGTTATGACACAGCAAGAAGG + Intronic
1106065371 13:26342952-26342974 CATCTGATGAGACAGGAAGAAGG - Intronic
1106668332 13:31877311-31877333 TATTTTCTGAAACATGAAGCTGG - Intergenic
1107107937 13:36667012-36667034 CTGTTTATGAGACTTGAAGCAGG - Intergenic
1107398855 13:40048712-40048734 CATGTCCTGAGGCATGCAGCAGG - Intergenic
1109158084 13:58936271-58936293 CATGTGAAGGGACCTGAAGCAGG + Intergenic
1109992394 13:70075113-70075135 CAAATTATGAGACTTGAAGAGGG + Intronic
1110935497 13:81282391-81282413 CACGTTCTTAAACATGAAGCTGG + Intergenic
1110935625 13:81284224-81284246 CTTGTTGTGAGACATGAACTTGG + Intergenic
1111545612 13:89731111-89731133 AATGTTATCAGACATAAAGAAGG - Intergenic
1115891599 14:38035961-38035983 CATGTTATGATACAGTAAGAAGG - Intronic
1119532035 14:75368989-75369011 CATGTTATGACACAGCAAGAAGG - Intergenic
1120161067 14:81144879-81144901 GCTATTATGAGACATGAAGGAGG + Exonic
1127187380 15:56493545-56493567 CATGTTATGACACAGCAAGAAGG - Intergenic
1128230983 15:66034963-66034985 CATGTTATGACACAGCAAGAAGG + Intronic
1129662569 15:77561261-77561283 GATGTTATGAAACATAAAACTGG - Intergenic
1130555483 15:84919558-84919580 CATGTTATGACACAGCAAGAAGG - Intronic
1130864832 15:87923902-87923924 CATGTTATGACACAGCAAGAAGG + Intronic
1131209379 15:90480622-90480644 CATGCTATGACAAATGAAGAGGG + Intronic
1133003526 16:2864077-2864099 CATGTTATGAGGCAGCAAGAAGG + Intergenic
1138975283 16:62199229-62199251 TAAGTTAGGAGACATGAAGGAGG + Intergenic
1138978778 16:62241247-62241269 CTGGTTATGAGACAAGAACCTGG + Intergenic
1139269555 16:65669663-65669685 GATGTTCTGAGAAATGCAGCTGG + Intergenic
1140596606 16:76423072-76423094 CATTCTATGAAACATGAAGTAGG + Intronic
1144082544 17:11777988-11778010 GATGTAAAGAGACATGAAGCTGG + Intronic
1144199497 17:12927211-12927233 AAGGTTTTGAGACATCAAGCTGG - Intronic
1146530252 17:33602457-33602479 CATGTTATGACACAGCAAGAAGG + Intronic
1149605544 17:57922388-57922410 CATTCTAGGAGACATGAATCTGG + Intronic
1149863429 17:60137227-60137249 CATGTTCTGAGGCAGGAAACTGG - Intergenic
1150345010 17:64397936-64397958 GATCTTCTGAGACAAGAAGCTGG - Intronic
1150913243 17:69410841-69410863 CATACGATGAGAAATGAAGCTGG + Intergenic
1153380301 18:4431022-4431044 CATGTTAGGAGCCGTGAAGTAGG - Intronic
1153980741 18:10307435-10307457 CATGTTATGACACAGCAAGAAGG + Intergenic
1155347621 18:24874368-24874390 CATGTTATGATGCATCAAGAAGG - Intergenic
1158166295 18:54544963-54544985 GATGTTATGAGAGATGACGCTGG - Intergenic
1160553042 18:79707269-79707291 CGTGTGGTGAGAGATGAAGCAGG + Intronic
1162674588 19:12289417-12289439 CATGGGATGAGTCATGAAGGAGG - Intronic
1162878854 19:13642111-13642133 CATGTTATGACACAGCAAGAAGG + Intergenic
1165940231 19:39411243-39411265 CCTGTTATGAGACCTGAGTCAGG + Intergenic
1166512186 19:43416351-43416373 CCTGTTATGAGACAGGAAGGAGG - Exonic
927536089 2:23860164-23860186 CATGTTATGACACAGCAAGAAGG + Intronic
927683062 2:25152915-25152937 CATGTTATGAGCTAGGAATCAGG + Intronic
930182494 2:48376398-48376420 CATGTTATCATACATAAAGTAGG + Exonic
930267950 2:49221980-49222002 CATTTTAATAGACAAGAAGCTGG + Intergenic
930411327 2:51028906-51028928 CATGCTATGACAGAAGAAGCAGG - Exonic
930626104 2:53699107-53699129 CATGTTATGACACAGCAAGAAGG - Intronic
931307330 2:61043069-61043091 CATGTTATGACACAACAAGAAGG + Intronic
932027207 2:68146768-68146790 CATGTTAGAAAACATGATGCAGG + Intronic
932861545 2:75297900-75297922 CATGTTATGACACAGCAAGAAGG + Intergenic
933556936 2:83842339-83842361 CATGTTATGAGAGATTGAGAGGG + Intergenic
934569308 2:95358668-95358690 CATGTTATGACACAGCAAGAGGG - Intronic
937113215 2:119383532-119383554 CATGTGATCAGACATGATCCAGG + Intergenic
939688927 2:145233852-145233874 CATGTTATGAGGCACCAAGATGG - Intergenic
940515330 2:154677240-154677262 CATGTTATGACACAGCAAGAAGG + Intergenic
941565619 2:167102354-167102376 CATGTTAAGAGATATAAAGATGG - Intronic
942548342 2:177088696-177088718 CATGTTCTGAGATATGGGGCGGG + Intergenic
942583847 2:177452429-177452451 CATGTTATCACACATAAAGGAGG - Intronic
944872867 2:203931947-203931969 CAAGTGATGAGAGATGAATCAGG + Intergenic
945863211 2:215147610-215147632 GATGTTTTGAGACATCATGCTGG - Intergenic
948390025 2:237605274-237605296 CATGCCATGTGACATGAAGGCGG - Intergenic
1168840746 20:908521-908543 CATGATATGTGCCATGAAGGAGG - Intronic
1169302906 20:4460465-4460487 CATGTGATGAAAGATAAAGCTGG - Intergenic
1169547106 20:6661431-6661453 CAAGTCATAAGACATAAAGCTGG - Intergenic
1170571632 20:17636054-17636076 CACGTCCTGAGACATGCAGCAGG + Intronic
1172895842 20:38299462-38299484 CCTTTTATGAGACGTGAAGCTGG + Intronic
1173777936 20:45726905-45726927 CCTGTTATGAATCATGAAACTGG + Intergenic
1174681456 20:52412674-52412696 CATGTTATGACACAGTAAGAAGG + Intergenic
1177607732 21:23403202-23403224 CATTTTATGGGACATTAATCAGG - Intergenic
1177709721 21:24757620-24757642 CATATTTTGAGAATTGAAGCTGG - Intergenic
1178143386 21:29709606-29709628 CATGTTCTTAGATATGAAGATGG - Intronic
1178343939 21:31808991-31809013 CATGTTATGACACAGCAAGAAGG + Intergenic
1181465531 22:23108698-23108720 CAGCTTATGAGGCAGGAAGCTGG - Intronic
1182401845 22:30084250-30084272 CATGTTATGACACAGCAAGAAGG - Intronic
1182951030 22:34376028-34376050 CATGTTATGACACAGCAAGAAGG - Intergenic
1185164145 22:49248469-49248491 TATCTTATCAGTCATGAAGCAGG + Intergenic
949212670 3:1524140-1524162 CATGTTATGATGCAGGAAGAAGG + Intergenic
949524303 3:4888264-4888286 GATGTTCTGATTCATGAAGCTGG + Intergenic
949764118 3:7506658-7506680 CATGTTATGACACAAGAAGAAGG - Intronic
950851603 3:16067443-16067465 CATGTTATGACACAGCAAGAAGG + Intergenic
951522800 3:23625274-23625296 CATGTTATGACACAACAAGAAGG - Intergenic
953169044 3:40490958-40490980 CATGTTATGACACAGCAAGAAGG + Intergenic
953684138 3:45062959-45062981 CATGTTGTGAGAAAGGGAGCAGG - Intergenic
954928633 3:54260405-54260427 CATGTTATGACACAGCAAGAAGG - Intronic
957036597 3:75299024-75299046 CATCTCATGAAACATGAAACAGG - Intergenic
957428975 3:80076915-80076937 CATGTAATGACACAGGAAGAAGG + Intergenic
958180371 3:90052137-90052159 CATATTATGAGAAATGAGCCAGG - Intergenic
958456384 3:94336903-94336925 CATGTTATGAAACAGCAAGGAGG - Intergenic
960547820 3:118936809-118936831 CATGTTAGGGGAAATGAAGCTGG + Intronic
960631298 3:119734074-119734096 CTTGTTAAGACACATGCAGCTGG + Intronic
960857658 3:122119776-122119798 CAGGTCATGAGCCATTAAGCTGG - Exonic
961608651 3:128118448-128118470 CTTGCTATGAGACCTGAGGCAGG - Intronic
962749382 3:138422352-138422374 CAGTTTAGTAGACATGAAGCTGG + Intergenic
964108697 3:153066904-153066926 CATGTTAAGAGAAAAAAAGCAGG - Intergenic
964971731 3:162571621-162571643 ATTGTTAAGAGACACGAAGCAGG - Intergenic
965000397 3:162945527-162945549 CATGTTATGATGCATCAAGAAGG + Intergenic
965386479 3:168052061-168052083 CACCTCATGAGAAATGAAGCTGG - Intronic
965649196 3:170915975-170915997 CATGTTATGACACAACAAGAAGG + Intergenic
966233192 3:177671654-177671676 GATGTTATCAGAGATGAGGCTGG - Intergenic
966394241 3:179485534-179485556 TAAGTTATGAAACATAAAGCAGG + Intergenic
967744663 3:193041946-193041968 CATGCCATGGGATATGAAGCTGG - Intergenic
968163274 3:196444388-196444410 CAGTTTACGAGCCATGAAGCTGG - Intergenic
968988499 4:3892945-3892967 GATGTTATGAAACATGAAAGGGG + Intergenic
969195204 4:5556627-5556649 CATTTTATGAAACCAGAAGCTGG + Intronic
969938742 4:10709109-10709131 TATGGTATCAGACATGAATCAGG + Intergenic
970222999 4:13829647-13829669 CATGTTATGACACAGCAAGAAGG + Intergenic
970813923 4:20131012-20131034 CATGTTCTGAGAGGGGAAGCAGG - Intergenic
970861064 4:20702978-20703000 CATGGTATCAGACTTTAAGCTGG + Intronic
971958466 4:33454023-33454045 CATGTACTTAGGCATGAAGCTGG - Intergenic
972260388 4:37402142-37402164 CATGTTATGACACAGCAAGAAGG + Intronic
972402397 4:38717899-38717921 CCTGATTGGAGACATGAAGCTGG - Intergenic
974688069 4:65257552-65257574 CAGGTTATGAGAGATGACCCAGG + Intergenic
974912501 4:68139954-68139976 CCTATTATGAGAAATGAAGTTGG - Intergenic
976788869 4:88854394-88854416 CATGTTATGAGAGAGGCTGCAGG - Intronic
978395121 4:108270619-108270641 CATGTTATGACACAGCAAGAAGG + Intergenic
978506036 4:109457439-109457461 CATGTTATGACACAGCAAGAAGG - Intronic
978847516 4:113291703-113291725 AATTTTATGAGAAGTGAAGCAGG + Intronic
979183772 4:117761460-117761482 AATGTTATGTGTTATGAAGCTGG + Intergenic
979351035 4:119644805-119644827 CATGTTATGATGCAGGAAGAAGG + Intergenic
979830305 4:125292359-125292381 CATGTTATGATGCATCAAGAAGG + Intergenic
982277072 4:153647075-153647097 CATGTGATGAGACAGCAAGAAGG - Intergenic
982385132 4:154792814-154792836 CATATCATAAGAAATGAAGCTGG + Intronic
983335915 4:166391910-166391932 GATGTTATAGGACAGGAAGCTGG + Intergenic
984273111 4:177572551-177572573 CATGTTATGACACAGCAAGAAGG - Intergenic
986531446 5:8740714-8740736 CACGTTATGGGAGCTGAAGCTGG - Intergenic
986886625 5:12245666-12245688 CATCTTATGAGACATACAGTAGG - Intergenic
986985784 5:13499689-13499711 CATGTTAGGACACAGCAAGCAGG + Intergenic
987437496 5:17913504-17913526 CATGAGATGAGACAAGAAGAAGG + Intergenic
988414125 5:30924431-30924453 CATGTTATGAGGCAATAAGAAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988650297 5:33141562-33141584 CATGTTATGAGGCAGCAAGGAGG + Intergenic
989377942 5:40785143-40785165 CATGTTCTGATACAGGAAGGAGG - Intronic
989383167 5:40829266-40829288 CATGTGATGAGTCTTGAAGCTGG - Exonic
989680575 5:44023728-44023750 CATGTTATAATGCATGAAGAAGG + Intergenic
989738886 5:44745292-44745314 CATGTGAGGAGCCAAGAAGCCGG - Intergenic
990985351 5:61636551-61636573 CATGTTATGACACAGCAAGAAGG + Intergenic
991458697 5:66833558-66833580 CAGGTTATGAAACAGGAATCTGG - Intronic
993650111 5:90509777-90509799 CTTGTGTTGAGAGATGAAGCTGG + Intronic
993846826 5:92954300-92954322 CATGTAATGAGACAACAAGAAGG - Intergenic
995737944 5:115323229-115323251 CATGTTGTGACACAGCAAGCAGG - Intergenic
996153209 5:120065142-120065164 AATGTTAAGAGACATGAGGTAGG - Intergenic
999909348 5:156180701-156180723 CAAATTATGAGACTTGAAGAGGG + Intronic
1001584953 5:172827544-172827566 CATGTTATGAGACAGGAGAAAGG + Intergenic
1001835989 5:174832967-174832989 CATGTTATGACACATCAAGAAGG - Intergenic
1004257827 6:14081167-14081189 CAAGGTATGAGACATGAAGAGGG + Intergenic
1004916565 6:20338290-20338312 CATGTAATGAATCAGGAAGCAGG + Intergenic
1006275343 6:33000888-33000910 CAGCTTGTGAGACATGAGGCAGG - Intergenic
1007031890 6:38635676-38635698 CATGTTATGACACAGCAAGAAGG + Intronic
1007374701 6:41448537-41448559 CATGAAAGGTGACATGAAGCAGG - Intergenic
1008019639 6:46561544-46561566 GAGGTGATGAGAGATGAAGCTGG + Intronic
1010062824 6:71644922-71644944 TATGTTATGTGAAATGAACCAGG - Intergenic
1014271571 6:119342412-119342434 AATGGTATCAGACATGAAGTGGG - Intronic
1014726694 6:124979572-124979594 CATGTTTTGAGAACTGAAGGAGG + Intronic
1015439817 6:133234839-133234861 CATGTTATGAGGCAGTAAGAAGG - Intergenic
1015906287 6:138120298-138120320 CATCTTCAGAGAAATGAAGCAGG - Intergenic
1016470278 6:144368151-144368173 CTTTTTATGAGACATGAAAAGGG - Intronic
1018208568 6:161458461-161458483 CATTTTAGGAGACAGGCAGCCGG - Intronic
1023660333 7:42464866-42464888 CAGTTGATGAGACATGAAGAAGG - Intergenic
1023784569 7:43693238-43693260 GATGATATAAGACTTGAAGCTGG - Intronic
1024123612 7:46269784-46269806 CATGTAATCAGACATGAATGGGG - Intergenic
1024460914 7:49658539-49658561 CATGTTATGAGATGTGTACCAGG - Intergenic
1027799989 7:82738530-82738552 CATGTTATGTTACATGAAAAGGG - Intergenic
1028873803 7:95798426-95798448 CATTTTATGAGACACTAAGCAGG + Intronic
1032935346 7:136723632-136723654 CATGTTATGACACAGCAAGAAGG + Intergenic
1034055881 7:148034505-148034527 CATGTTATGACACAGCAAGAAGG + Intronic
1034056129 7:148036526-148036548 CATGTTATGACACAGCAAGAAGG + Intronic
1036945804 8:13093749-13093771 TATTTTATGAGAAATGGAGCTGG - Intronic
1037333905 8:17773573-17773595 CATGTTATGACACAGCAAGATGG - Intronic
1039853753 8:41395216-41395238 CATGTTATGACACAGCAAGAAGG - Intergenic
1040675680 8:49746599-49746621 CATGTGATGATACAGCAAGCAGG - Intergenic
1041933049 8:63308313-63308335 CATGTTATGACACATTAAGAAGG + Intergenic
1042281413 8:67060663-67060685 CATATTATGACAAATGAAGATGG + Intronic
1043098740 8:76011389-76011411 CATGTAACGAGAGATGAAACAGG + Intergenic
1043506185 8:80905392-80905414 CATGTTATGACACAGCAAGAGGG + Intergenic
1043940969 8:86195362-86195384 CATTTTATGATAAATGAAGATGG + Intergenic
1044897387 8:96906801-96906823 TATGTGATGTGACAGGAAGCAGG - Intronic
1045046740 8:98286143-98286165 CATGTTATGACACAGCAAGAAGG + Intronic
1047648818 8:126898223-126898245 TAAGTCATGAGACATGAAACTGG - Intergenic
1049267727 8:141678070-141678092 CATCTTATGGGTCAGGAAGCTGG + Intergenic
1050930665 9:11320368-11320390 CATGTTTTAACAAATGAAGCAGG - Intergenic
1050950070 9:11578791-11578813 TGTGTTAGGAGACATGAAACTGG - Intergenic
1051128207 9:13829492-13829514 TATCTTAGCAGACATGAAGCAGG - Intergenic
1055606937 9:77979931-77979953 CATGTTATGAGACAGAAAATAGG + Intronic
1056620463 9:88208551-88208573 CATGTTATGACACAGCAAGAGGG - Intergenic
1056941152 9:90957822-90957844 GATGTTTTGAGAGATGAAGTAGG + Intergenic
1056976095 9:91256288-91256310 CTTGTAATGAGACAGGAAGTGGG + Intronic
1057554883 9:96080074-96080096 TCTGTGATGAGACCTGAAGCGGG - Intergenic
1186006488 X:5077999-5078021 AATGTTATGAGACAGCAAGAAGG - Intergenic
1186447023 X:9639560-9639582 CATTTTATGAGCCATAAACCTGG + Intronic
1192123643 X:68480041-68480063 CATGTTATGACACAGTAAGAAGG + Intergenic
1193722855 X:85006871-85006893 CATGGTATGAGTCCTGAACCTGG + Intronic
1197480635 X:126980960-126980982 AATGTTATGATATATGATGCAGG - Intergenic
1198673909 X:139111301-139111323 CATGTTATCAGACATGGAAGAGG + Intronic
1198798111 X:140421194-140421216 CATGTTATGACACAGCAAGAAGG - Intergenic
1199483096 X:148319769-148319791 CAGGTTGTGAAACATGAAGTGGG - Intergenic
1199510257 X:148613646-148613668 CATGTGATGGGAGATAAAGCTGG - Intronic
1201309580 Y:12584193-12584215 CATGTTAAGTGAAATGAACCAGG + Intergenic