ID: 924214142

View in Genome Browser
Species Human (GRCh38)
Location 1:241802716-241802738
Sequence CATTAATTATGGAATCTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924214142 Original CRISPR CATTAATTATGGAATCTAGG TGG Intergenic
901158730 1:7158681-7158703 TGTTAATTATAGAATCCAGGTGG + Intronic
901624184 1:10614337-10614359 CATTAATAATGAAAACCAGGGGG + Intronic
904543824 1:31252777-31252799 TTTGAATTATTGAATCTAGGTGG + Intergenic
909158313 1:72110662-72110684 CATTAATTTTGAAATTTAGGAGG + Intronic
910422089 1:87077100-87077122 CATTAATTTTGGCATCCAGTGGG - Intronic
911136063 1:94442128-94442150 CATTAATTGGGAAATCTAGATGG + Intronic
911277806 1:95883402-95883424 TGTTAATTATAGAATCTAGGTGG - Intergenic
911513459 1:98837487-98837509 TTTTAATGATGGAATCCAGGTGG - Intergenic
916441575 1:164831113-164831135 TATTAATGACAGAATCTAGGTGG - Intronic
918024541 1:180730526-180730548 CTTTAAGTATGGAATATAGGGGG - Intronic
918174865 1:182034968-182034990 TATTAATTGGTGAATCTAGGTGG - Intergenic
918823796 1:189295901-189295923 CATTGATGATGGAAATTAGGAGG + Intergenic
924214142 1:241802716-241802738 CATTAATTATGGAATCTAGGTGG + Intergenic
1062909144 10:1201032-1201054 CATTAATTACCGAATCTACCTGG + Intronic
1064093797 10:12407655-12407677 GATTGAATATGAAATCTAGGAGG + Intronic
1069065125 10:63934482-63934504 CATGAAATGTGAAATCTAGGTGG - Intergenic
1069672396 10:70219001-70219023 TATTCATTATAGAATCAAGGTGG + Intronic
1071866306 10:89736343-89736365 ATTTAATCATGGAATCTATGAGG + Intronic
1073194496 10:101678007-101678029 TATTAATTGTAGAACCTAGGTGG + Intronic
1076757577 10:132580720-132580742 CATTAATGATAGAATCTAAGTGG - Intronic
1078589111 11:12622501-12622523 CAGGAACTATGGAATCTGGGAGG + Intergenic
1079937075 11:26630392-26630414 CAATAATAAAGGAATCTATGTGG - Intronic
1084079306 11:66809910-66809932 CATTAAATTTGGAAACTCGGGGG - Intronic
1088828415 11:113515166-113515188 CATTAATTATGGACTCTGAAAGG + Intergenic
1088829102 11:113520240-113520262 CATTAATTATGGACTCTGAAAGG + Intergenic
1088864516 11:113835049-113835071 CATTAATTTTTTAAGCTAGGTGG + Intronic
1089265566 11:117257987-117258009 TATTAATTGTTGAATCCAGGTGG - Intronic
1092829343 12:12428794-12428816 TATTAGTTGTTGAATCTAGGTGG + Intronic
1093743801 12:22717126-22717148 TGTGAATTATAGAATCTAGGTGG - Intergenic
1099211977 12:79802077-79802099 CATTAATTCTGGGATATAAGAGG + Intronic
1099215915 12:79853313-79853335 CTCTAATTATGGAATATATGAGG + Intronic
1102553159 12:113707023-113707045 CATTAATGGTAGAACCTAGGTGG - Intergenic
1106642625 13:31600408-31600430 CTTTGCTCATGGAATCTAGGGGG + Intergenic
1109085650 13:57968067-57968089 AAATATTTATAGAATCTAGGTGG + Intergenic
1110819506 13:79898144-79898166 AAATAATTATGAAATCTAGATGG - Intergenic
1112663994 13:101547078-101547100 CATTATTTTTGTAATCTTGGTGG - Intronic
1113499152 13:110759653-110759675 GATTAAGTAGGGAATCTTGGAGG + Intergenic
1115632622 14:35260568-35260590 CATTCACTATGGCACCTAGGTGG - Intronic
1116161021 14:41266577-41266599 CATTAAATATGGAAGGGAGGTGG - Intergenic
1116787744 14:49306734-49306756 TATTAATTGTGGAAACTATGTGG - Intergenic
1116862952 14:50008940-50008962 CAGGAATTATGAAATCCAGGTGG + Intergenic
1117475491 14:56090451-56090473 CATTAAGTAGGGAAAATAGGTGG + Intergenic
1120952967 14:90060009-90060031 TGTTAATTGTAGAATCTAGGTGG + Intergenic
1124560948 15:30772675-30772697 TGTTAATTGTAGAATCTAGGTGG - Intronic
1124669584 15:31626376-31626398 TGTTAATTGTAGAATCTAGGTGG + Intronic
1124697128 15:31873037-31873059 CATTAATTATTGATTCTTTGTGG + Intergenic
1126223422 15:46241781-46241803 TATTAATTATTGAATCTGGTTGG + Intergenic
1127440881 15:59006571-59006593 TGTTAATCATAGAATCTAGGTGG - Intronic
1128121994 15:65156860-65156882 CATCAATTACGGGATGTAGGTGG - Exonic
1128286328 15:66440001-66440023 CATAAGTTGTAGAATCTAGGTGG - Intronic
1130800663 15:87259718-87259740 CAAAAATCAAGGAATCTAGGAGG - Intergenic
1135935463 16:26776158-26776180 CAGAAATTTTGGAATCTTGGAGG - Intergenic
1137507966 16:49072497-49072519 TGTTAATTATGGAATCTTAGTGG - Intergenic
1137936230 16:52637881-52637903 CATGAATTATGGAAGAAAGGTGG + Intergenic
1138742610 16:59328348-59328370 CTTTCATTTTAGAATCTAGGGGG + Intergenic
1138765271 16:59594834-59594856 CATTTATTATGGAATAGAAGGGG + Intergenic
1140854153 16:78963079-78963101 TGTTAATTGTAGAATCTAGGTGG - Intronic
1143245080 17:5477619-5477641 TATTAATTACAGAATCTATGTGG + Intronic
1145852598 17:28115949-28115971 TATTAATTACTGAATCTAGGTGG - Intronic
1148144831 17:45356711-45356733 CGTTAATTGTAGAATCTATGTGG - Intergenic
1153157930 18:2169961-2169983 CCTTAATGATGGAATGTGGGTGG + Intergenic
1155244333 18:23893058-23893080 AATTAATTATGGAAAATATGGGG - Intronic
1156097744 18:33555947-33555969 CAATAATTATTGAATCTAGGTGG + Intergenic
1156471596 18:37380484-37380506 GATTAATAATGGATGCTAGGTGG - Intronic
1157135453 18:45049797-45049819 ATTTAATTATGGAATTTAGGGGG + Intronic
1157950235 18:52028632-52028654 AAGCAATTATAGAATCTAGGAGG + Intergenic
1158651336 18:59289485-59289507 TATTAATTTTAGAATCTAGATGG - Intronic
1158803159 18:60937125-60937147 CATTAATTATTGAATAATGGTGG - Intergenic
1163326145 19:16604575-16604597 CATGCAGAATGGAATCTAGGTGG - Intronic
1166224818 19:41388331-41388353 CATTACTGATGGAAACTAGCTGG - Intronic
1168494706 19:56839261-56839283 CATCAAACATGGCATCTAGGTGG + Intronic
926676369 2:15625601-15625623 TGTTAATTGTTGAATCTAGGTGG + Intronic
927479776 2:23443139-23443161 TAATAATTTTTGAATCTAGGTGG - Intronic
930515019 2:52395418-52395440 CATTTATTATGAAATTTTGGGGG - Intergenic
931218374 2:60266616-60266638 CATATATTCTGGAATCTAGCTGG + Intergenic
931903126 2:66813006-66813028 CAATAATGGTAGAATCTAGGTGG - Intergenic
933077111 2:77943105-77943127 CATGAATAATGGAATGTAGATGG - Intergenic
938594610 2:132775266-132775288 CATTAAGTATGAAAAATAGGAGG - Intronic
939130743 2:138233364-138233386 CATTAATTATTGAATTCAGTTGG - Intergenic
940371572 2:152907557-152907579 TGTAAATTATGGACTCTAGGTGG - Intergenic
940583998 2:155620530-155620552 AATTAATTAAGGCATCTAGACGG - Intergenic
940886920 2:158998300-158998322 TCTTAATTATAGAATCTAGGTGG - Intronic
944903422 2:204238834-204238856 CATGAATCAAGGAATGTAGGCGG + Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945546685 2:211162786-211162808 TATTGATTATAGAATCTGGGTGG - Intergenic
945634317 2:212328426-212328448 CCTTAATTATAGAATCTAGGAGG - Intronic
946067667 2:217003177-217003199 CATCATTTCTGGAATCAAGGGGG + Intergenic
1169727355 20:8750464-8750486 TTTTAATTATGGAATCCGGGTGG - Intronic
1169842130 20:9950971-9950993 CATAAAAAATGGACTCTAGGTGG + Intergenic
1170996136 20:21360971-21360993 CATTAATTATGGAATGTATCAGG + Intronic
1176864461 21:14037321-14037343 TATTAATTATTGAATCTGGTTGG + Intergenic
1178053507 21:28773625-28773647 CATTATTTATGGGATCTCAGTGG - Intergenic
1178830849 21:36055113-36055135 CATTAGTCATTGATTCTAGGAGG - Intronic
1183258747 22:36780542-36780564 TAATAAATATGGAATATAGGTGG - Intergenic
1184584169 22:45436501-45436523 TATTAATTGTAGAATCTAGGTGG - Intergenic
949141072 3:633857-633879 CATTAATTAGAGAAACTAGGTGG - Intergenic
950914612 3:16631959-16631981 CAGTAATGATGGAATTTAGATGG - Intronic
951638703 3:24809869-24809891 TATTTATTATAGAATCCAGGAGG + Intergenic
952237983 3:31499925-31499947 CATGAATAATGGAATGTTGGAGG + Intergenic
952241791 3:31538130-31538152 TATTAATTGTAGAATCTAGGTGG - Intronic
952295437 3:32058267-32058289 TATCAATTATAGAATCTAGTTGG + Intronic
952557536 3:34549976-34549998 TATTAATTATTGAATCTAGATGG - Intergenic
952699264 3:36308503-36308525 TGTTAATGATAGAATCTAGGTGG - Intergenic
955296539 3:57740460-57740482 TGTTAATAATAGAATCTAGGTGG - Intergenic
955861938 3:63340385-63340407 AATTAATGGTAGAATCTAGGTGG - Intronic
958942651 3:100332711-100332733 TGTTAATTATTAAATCTAGGAGG + Intergenic
958942736 3:100333445-100333467 TGTTAATTATTAAATCTAGGAGG - Intergenic
960341807 3:116484110-116484132 TATAAACTATGGACTCTAGGTGG + Intronic
960672288 3:120165434-120165456 AATTTATCATGGAATCTTGGGGG - Intronic
962113437 3:132474731-132474753 CATTAATGACAGAATCTTGGTGG - Intronic
962418490 3:135205679-135205701 TATTAATTCCAGAATCTAGGTGG - Intronic
962889489 3:139658587-139658609 AATTAATGGTAGAATCTAGGTGG - Intronic
963625120 3:147661663-147661685 CATTAATTATGTCATCTAATTGG - Intergenic
963822450 3:149912623-149912645 TGTTAATTATAGAATCCAGGTGG + Intronic
963846565 3:150164626-150164648 TGTTAATTGTAGAATCTAGGTGG + Intergenic
964890031 3:161523316-161523338 CTTTAATTCTGGGACCTAGGTGG + Intergenic
965319174 3:167230562-167230584 CATTCATTCAAGAATCTAGGGGG + Intergenic
965732042 3:171782589-171782611 TATTGATTGTAGAATCTAGGTGG + Intronic
966395966 3:179503363-179503385 TATTCATTATAGAATCTAGGTGG + Intergenic
966639930 3:182178318-182178340 CATCAATTATGGAAGAAAGGTGG - Intergenic
966665742 3:182469153-182469175 TGTTAATTATAAAATCTAGGTGG - Intergenic
968719695 4:2192290-2192312 TATTCATTGTAGAATCTAGGTGG - Intronic
970349799 4:15190909-15190931 TGATAATTATAGAATCTAGGTGG + Intergenic
971736917 4:30465544-30465566 AATGAATCATGGAATCTAAGTGG + Intergenic
972511953 4:39775204-39775226 CATTAATCATAGAATCTAGATGG - Intronic
972947621 4:44276340-44276362 CTTTAATAATGTATTCTAGGTGG + Intronic
973697896 4:53508665-53508687 AGTTAAATATGGAATCTGGGAGG - Intronic
976283978 4:83353314-83353336 AGTTAATTGTAGAATCTAGGTGG - Intergenic
976622384 4:87142292-87142314 TGTTAATTGTTGAATCTAGGTGG - Intergenic
978458558 4:108924379-108924401 CTTTACATATGGAATCTAGCGGG - Intronic
984000455 4:174235256-174235278 TTTTAATTGTAGAATCTAGGTGG + Intergenic
985402852 4:189608933-189608955 CATTATTTATGAAATTTAAGAGG + Intergenic
985803819 5:2023727-2023749 CATTAATAATGGCATGTAAGAGG - Intergenic
986814920 5:11398557-11398579 CAGTTATTTTGGAATCTATGCGG + Intronic
988300820 5:29424117-29424139 CATGAATAATTGAATCTATGGGG - Intergenic
988977201 5:36527082-36527104 CATTAATTATGGAAAATGTGAGG + Intergenic
991599337 5:68336796-68336818 CATGAGCTATGGAATGTAGGTGG + Intergenic
992481436 5:77156038-77156060 CATTCATTATGCAATTTGGGGGG + Intergenic
992639381 5:78755710-78755732 TACTAATTGTGGAACCTAGGTGG - Intronic
994491142 5:100445209-100445231 CAGTAATTATGGAATCTGGGAGG + Intergenic
1000557920 5:162750133-162750155 TGATAATTGTGGAATCTAGGTGG + Intergenic
1000874344 5:166617864-166617886 CATTAATTGTAGAATCTAGGTGG + Intergenic
1002962121 6:1925114-1925136 CATTAATTACAGAATCTGGGTGG + Intronic
1006776119 6:36593874-36593896 CCTTCAGTGTGGAATCTAGGCGG + Intergenic
1006968602 6:38016312-38016334 CAAGAATTATTTAATCTAGGTGG - Intronic
1008691498 6:53984225-53984247 CATTAATAATTGATTCTATGTGG + Intronic
1009004057 6:57759990-57760012 CATGAATAATTGAATCTATGGGG - Intergenic
1009345122 6:62605635-62605657 CATTAATAATAGCATCTATGAGG + Intergenic
1009549127 6:65063955-65063977 CATTAATAATAAAGTCTAGGAGG - Intronic
1012657129 6:101838379-101838401 AATTGATTAAGGAATCTTGGTGG - Intronic
1014474561 6:121856466-121856488 CATTTATTATGGAATGTAACTGG + Intergenic
1015072936 6:129119109-129119131 CATAAAAAATGAAATCTAGGAGG - Intronic
1015591988 6:134831040-134831062 CATTAATAATTGACTTTAGGGGG - Intergenic
1017267135 6:152460607-152460629 AATTAATTACCCAATCTAGGTGG + Intronic
1021532383 7:21662319-21662341 TATTAATTGTAGAATCTAAGTGG - Intronic
1022565562 7:31397159-31397181 AATTAAGTATGGAAAGTAGGAGG - Intergenic
1022879518 7:34571987-34572009 CAGTAATTGAAGAATCTAGGTGG - Intergenic
1023342794 7:39239789-39239811 CACTAATTATGGAAACTATCAGG + Intronic
1027475336 7:78623668-78623690 CATTTATAAGGCAATCTAGGTGG - Intronic
1029950618 7:104580396-104580418 CAACAATTCTAGAATCTAGGTGG - Intronic
1030447403 7:109664442-109664464 TGTTAATTGTAGAATCTAGGTGG - Intergenic
1033903770 7:146175577-146175599 CATTAATTTTAGAATCTACGTGG + Intronic
1035416578 7:158694351-158694373 CAATAATTATGGACTCTGGCAGG + Intronic
1039385107 8:37128756-37128778 CATTGATTATGCAATCGTGGAGG - Intergenic
1041643225 8:60225408-60225430 CAGTCATTATGGAATTCAGGGGG - Intronic
1042881349 8:73494336-73494358 TATTAATTATACAATTTAGGTGG + Intronic
1043007949 8:74844141-74844163 TATTAATTATGGACTCTAGGAGG + Intronic
1044644743 8:94427012-94427034 CATTAATTGCAGAATCTATGTGG + Intronic
1045516035 8:102862338-102862360 TGTTAATTACAGAATCTAGGTGG + Intronic
1045943148 8:107762939-107762961 CATAAATTGTGGAATAGAGGTGG + Intergenic
1046564406 8:115880535-115880557 AATTAATTATGTAAAATAGGAGG + Intergenic
1047351283 8:124077068-124077090 CATTCACTCTGGAATCAAGGTGG + Intronic
1048860474 8:138720965-138720987 TATTGAATATGGAACCTAGGAGG - Intronic
1052174468 9:25441663-25441685 CATTAAGAATGGAATGAAGGGGG + Intergenic
1055122038 9:72671641-72671663 CATTAATTTTGGTATACAGGAGG + Intronic
1055879437 9:80981765-80981787 TATTAATTGTAGAATCTAGTGGG - Intergenic
1056436389 9:86579014-86579036 CATTATTTGTTGAATCTATGTGG + Intergenic
1059082477 9:111265263-111265285 AATTAAAGATGGAATTTAGGTGG + Intergenic
1060713014 9:125889692-125889714 CATTAATTATGCAGTCAGGGCGG + Intronic
1186524867 X:10238946-10238968 CATGGATTTTGGAATCTATGGGG - Intergenic
1187340596 X:18417795-18417817 TGTTAATTGTAGAATCTAGGTGG - Intergenic
1187867027 X:23732473-23732495 TAATAAGTATGGAATCCAGGTGG + Intronic
1189055301 X:37693421-37693443 TGTTAATTGTAGAATCTAGGTGG - Intronic
1189512644 X:41678778-41678800 ATTTAATTGTAGAATCTAGGTGG - Intronic
1189714580 X:43852523-43852545 CATTAATTGTGGAGTCTAGTTGG + Intronic
1189779172 X:44497681-44497703 TTTTAATTGTAGAATCTAGGTGG + Intergenic
1190636451 X:52439371-52439393 CATTAATTATGTTATCCAGTGGG - Intergenic
1190837019 X:54110522-54110544 TATTAATTATAGAATCTAGGTGG + Intronic
1193138946 X:78005217-78005239 TATTAATTGTAGAATCTAGCTGG - Intronic
1193977945 X:88146682-88146704 TAGCAATTATGGAAACTAGGTGG - Intergenic
1194504661 X:94718179-94718201 CATTAATTTTGGAAACTACTTGG + Intergenic
1194880643 X:99247289-99247311 AGTTAATTATGGAATCTATAGGG - Intergenic
1195864747 X:109418490-109418512 TATTAATTATGATATCTAGAAGG + Intronic
1196027588 X:111057346-111057368 CCTTAATTATTGAATCTAGGTGG - Intronic
1196923986 X:120613776-120613798 CATTATTTAAGGAGTCTAGTGGG - Intronic
1197755918 X:129994702-129994724 CATTAATTCTGGTATTTAGTGGG - Intronic
1198227102 X:134655262-134655284 TGTTAATTGTGGAATCTTGGTGG - Intronic
1198674148 X:139113971-139113993 CATTAATTATTGAAATTAAGTGG - Intronic
1200814578 Y:7518261-7518283 CCTTGATTATGGAATCTAAGAGG - Intergenic