ID: 924216182

View in Genome Browser
Species Human (GRCh38)
Location 1:241824717-241824739
Sequence CTGGAGCCACAGCTCAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924216179_924216182 -1 Left 924216179 1:241824695-241824717 CCAGCAAGGGGTAGAGGCACTCC No data
Right 924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG No data
924216174_924216182 20 Left 924216174 1:241824674-241824696 CCAGCTCAGGGAAGATAAATACC No data
Right 924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924216182 Original CRISPR CTGGAGCCACAGCTCAAAGA TGG Intergenic
No off target data available for this crispr