ID: 924220307

View in Genome Browser
Species Human (GRCh38)
Location 1:241867687-241867709
Sequence CTGTGCCAAGGCAATTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924220307_924220310 9 Left 924220307 1:241867687-241867709 CCCATTTAATTGCCTTGGCACAG 0: 1
1: 0
2: 5
3: 43
4: 369
Right 924220310 1:241867719-241867741 ATCAGCTGACCACATATATGTGG 0: 2
1: 2
2: 19
3: 145
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924220307 Original CRISPR CTGTGCCAAGGCAATTAAAT GGG (reversed) Intronic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
906440589 1:45839856-45839878 ATTTGCCAAGGCAATTTAATGGG + Intronic
906681909 1:47732579-47732601 GTGTCCCAAGACAATTACATCGG + Intergenic
907478652 1:54727234-54727256 GTGTGCCAAGACCATTCAATAGG + Intronic
907618793 1:55953897-55953919 GTGTGCAAAAGCTATTAAATGGG + Intergenic
908291781 1:62674684-62674706 TGGTGCCAAGGCAATTCAATTGG + Intronic
908430985 1:64057269-64057291 GAGTGCCAAGACAATTCAATGGG - Intronic
908636019 1:66166113-66166135 AGATGCCAAGGCAATTCAATGGG + Intronic
909226305 1:73027821-73027843 GTGTGCCAAGATAATTAAATGGG + Intergenic
909252212 1:73372936-73372958 CTGTTACAAGGCAATTGAAGGGG + Intergenic
909290338 1:73874935-73874957 CTGTGGGAAGGCAAATATATGGG + Intergenic
909554732 1:76941029-76941051 CTGTGCCCAGCAATTTAAATTGG - Intronic
909887035 1:80954799-80954821 ATGTACCAAGGCAATTTAATGGG + Intergenic
911140965 1:94502133-94502155 AAGTGCCAAGGCAAATAACTGGG - Intronic
911699691 1:100938001-100938023 AGATGCCAAGGCAATTCAATGGG - Intronic
912064120 1:105713998-105714020 GAGTGCCAAGACAATTCAATGGG - Intergenic
912690030 1:111797987-111798009 CTGAGCCAAGGCAATGACACTGG + Intronic
913365637 1:118035020-118035042 CTGTGCCTACCCAATTAAAGGGG + Intronic
916300869 1:163272674-163272696 CAGTGCCAAGACAATTCAAAGGG - Intronic
916710956 1:167407624-167407646 AGGTGCCAAGGCAATTCAATAGG + Intronic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
919936849 1:202257584-202257606 CAGTGCTAAGACAATTCAATAGG - Intronic
920897328 1:210067069-210067091 GGGTGCCAAGGCCATTCAATGGG - Intronic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
922090290 1:222389380-222389402 CTGTGCCAAGGATTTTAACTTGG - Intergenic
923289165 1:232527419-232527441 CTGTGCCTAGTGAATTAAAATGG - Intronic
923511563 1:234658027-234658049 CCGGGCCAAGTCAATTAAGTTGG + Intergenic
924220307 1:241867687-241867709 CTGTGCCAAGGCAATTAAATGGG - Intronic
924220434 1:241869286-241869308 ATGTGCCAAGACAATTAAATGGG + Intronic
1063599920 10:7471495-7471517 ATGTGCTAAGACAATTCAATGGG + Intergenic
1068105081 10:52605008-52605030 GGGTGCCAAGACCATTAAATGGG + Intergenic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068503652 10:57871144-57871166 AAGTGACAAGGCAATTAATTGGG - Intergenic
1068931879 10:62598801-62598823 AGGTGCTAAGGTAATTAAATGGG + Intronic
1069203270 10:65650343-65650365 AGGTGCCAAGGCAATGCAATGGG + Intergenic
1069751993 10:70750724-70750746 GTGTACCAAGGCCATTCAATGGG + Intronic
1069795881 10:71051453-71051475 CTCTGCACAGGCATTTAAATAGG + Intergenic
1070495000 10:77013494-77013516 CTGTGCCAAGGCAGATTGATTGG - Intronic
1071020676 10:81051241-81051263 TAGTGCCAAGGCAATTTAGTAGG + Intergenic
1071995595 10:91145735-91145757 GAGTGCCAAGACAATTCAATGGG + Intergenic
1072388013 10:94952005-94952027 GGTTGCCAAGGCAATTCAATAGG - Intronic
1073223379 10:101895108-101895130 AGGTGGCAAGGCAATTAAATAGG + Intronic
1073992292 10:109275858-109275880 CTGCTCCAAGGCACTTAAAGGGG - Intergenic
1074142986 10:110692035-110692057 GTGTACCAAGGCCATTCAATGGG - Intronic
1074336028 10:112576449-112576471 CAGTTCTAAGGCTATTAAATTGG - Intronic
1074844197 10:117382679-117382701 AGGTGCCAAGACATTTAAATGGG - Intergenic
1077908505 11:6554206-6554228 ATGTGCCAAGATAATTCAATGGG + Intronic
1078345374 11:10543683-10543705 ATATGCCAAGGCAATTCAGTGGG + Intergenic
1078632932 11:13020016-13020038 GTGTGCCAAGACCATTTAATAGG - Intergenic
1079440053 11:20504261-20504283 GGGAGCCAAGGCGATTAAATCGG - Intronic
1080327345 11:31092009-31092031 TTCTGCCAAGGAAATTAAAGGGG + Intronic
1080417272 11:32080501-32080523 CTGTGGGAAGGCAAATATATGGG + Intronic
1080506709 11:32921975-32921997 AGGTGCCAAGACAATTCAATAGG + Intronic
1080556990 11:33427041-33427063 CTTTACCCAGGCAACTAAATGGG + Intergenic
1080570845 11:33555536-33555558 AGGTGCCAAGGCTATTCAATGGG + Intronic
1080702743 11:34658097-34658119 CTGGGTCAAAGCAATTTAATTGG + Intronic
1082205288 11:49426115-49426137 CTTTTCTAAGGAAATTAAATTGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1085149856 11:74242242-74242264 AGGTGCCAAGACAATTAAATGGG - Intronic
1085367559 11:75964870-75964892 ACATGTCAAGGCAATTAAATGGG - Intronic
1086649815 11:89274421-89274443 CTTTTCTAAGGAAATTAAATTGG + Intronic
1087495507 11:98886086-98886108 TGGTGCCAAGGACATTAAATAGG - Intergenic
1087906012 11:103698511-103698533 TAGTGCCAAGACAATTCAATGGG - Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1089854130 11:121526219-121526241 AGGTACCAAGGCAATTCAATGGG - Intronic
1090200115 11:124848005-124848027 CTATTCCAAGGCAATTACACTGG - Intergenic
1090244262 11:125204511-125204533 CTGTGACAATGGGATTAAATTGG - Intronic
1090966747 11:131604819-131604841 GTGTGCCAAGAAAATTCAATGGG - Intronic
1091081731 11:132676166-132676188 TAGTGCCAAGGCCATTGAATAGG + Intronic
1091158748 11:133399530-133399552 CTGTGCCATGGCAATGAGGTTGG - Intronic
1091163443 11:133448300-133448322 AGGTACCAAGGCAATTTAATGGG - Intronic
1091198857 11:133755164-133755186 AGGTGCCAAGGCAATTCACTGGG + Intergenic
1091210892 11:133859020-133859042 AGGTGCCAAGGCAATTCAGTGGG - Intergenic
1091270303 11:134306629-134306651 CTGTGCCATGGATATTAAAACGG - Intronic
1091313266 11:134590776-134590798 AAGTGCCAGGGCAATTCAATGGG - Intergenic
1091551815 12:1541124-1541146 CAGTGCCAAGGCAGTGAAACAGG - Intronic
1091981495 12:4867844-4867866 CTGAACCAAAGCAATTAAAGAGG - Intergenic
1092037856 12:5355496-5355518 AAGTGCCAAGACAATTCAATGGG + Intergenic
1092851235 12:12628886-12628908 AGGTGCCAAAGCAATTAAATGGG - Intronic
1093170375 12:15853196-15853218 CAGTGTCAAAGCAATTACATAGG + Intronic
1093975627 12:25418520-25418542 AGGTGCCAAGTCAATTCAATAGG - Intronic
1095139919 12:38649014-38649036 CTGTTTCATGGAAATTAAATTGG + Intronic
1097135661 12:56852589-56852611 GAGTGCCAAGACAATTCAATAGG - Intergenic
1097390193 12:59002248-59002270 TTGTGCTAAGGCAATAAAACCGG + Intergenic
1098566005 12:71936713-71936735 ACGTGCCAAGACAATTCAATGGG - Intergenic
1098979310 12:76937796-76937818 GGGTGTCAAGGCAATTCAATGGG + Intergenic
1101010087 12:100440486-100440508 CTGTACCACGGCACTTAAAAAGG + Intergenic
1101264557 12:103070062-103070084 CAGTGGCAAGGAAATAAAATTGG - Intergenic
1102949099 12:117016898-117016920 TGGTGCCAAGACAATTGAATGGG - Intronic
1103287256 12:119812951-119812973 CTGTGCCTAGGCAGTAAAAGGGG - Intronic
1103423111 12:120806377-120806399 CGGTGCCAAGGTAATTCAACTGG + Intronic
1105268623 13:18847861-18847883 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1107271841 13:38628341-38628363 GTGTGCCAAGATAATTAACTGGG - Intergenic
1109007501 13:56897922-56897944 CTGTGAAGAGGCAAGTAAATGGG - Intergenic
1110732463 13:78895069-78895091 AGGTGCCAAGGCAATTCAATGGG - Intergenic
1110762651 13:79247548-79247570 ATGTGGCAAGGCAATTTAATGGG - Intergenic
1111095252 13:83505556-83505578 ATGTTCCAAGAGAATTAAATGGG + Intergenic
1113631401 13:111887688-111887710 AGGTGCCAAGACAATTCAATGGG - Intergenic
1113658301 13:112084925-112084947 AGGTGCCATGGCAATTTAATGGG - Intergenic
1113809402 13:113129253-113129275 CTCTGCCAAGGGAATTCCATAGG - Intronic
1114172608 14:20288701-20288723 CCGTGCCAGGCCAATTCAATTGG + Exonic
1115176390 14:30566027-30566049 GGGTGCCAAGACCATTAAATGGG - Intronic
1116152802 14:41163833-41163855 TTGTGACAAGGCATTGAAATAGG - Intergenic
1118058151 14:62104670-62104692 CTGTGCTAAGACAATGAGATTGG + Exonic
1118298514 14:64592734-64592756 GGGTGCCAAGACAATTCAATGGG + Intergenic
1118928895 14:70221112-70221134 GTGTGCCAAGACCATTCAATGGG - Intergenic
1119082480 14:71708696-71708718 AGGTACCAAGGCAATTCAATGGG - Intronic
1120806518 14:88757199-88757221 TGGTGCCAAGACAATTCAATGGG + Intronic
1120956124 14:90083894-90083916 GTGTGCTAAAACAATTAAATGGG - Intronic
1120956127 14:90083941-90083963 GTGTGCTAAAACAATTAAATGGG - Intronic
1120963083 14:90142667-90142689 CAGTGCCAAGGCAATTCACTTGG - Intronic
1122655821 14:103258623-103258645 CTGGGCCCAGGAAATTAACTCGG - Intergenic
1202830680 14_GL000009v2_random:26096-26118 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1123957150 15:25349145-25349167 AGGTGCAAAGGCAATTCAATGGG + Intronic
1125065644 15:35482591-35482613 AGGTTCCAAGGCAATTCAATGGG + Intronic
1125215374 15:37266974-37266996 GGGTGCCAAGACAATTCAATGGG + Intergenic
1125275638 15:37987630-37987652 GTGTGCCAAGACAATTCACTGGG - Intergenic
1125696208 15:41639475-41639497 CTGTGCCGAGCTAATTAGATAGG - Intronic
1125830445 15:42712582-42712604 GGGTGCCAAGACAATTCAATGGG - Intronic
1125890642 15:43263536-43263558 AGGTGCCAAGACAATTCAATGGG + Intronic
1126384495 15:48080114-48080136 CTGTGCCAAATCAAATAAAAGGG - Intergenic
1127209241 15:56755622-56755644 GTGTGCCAAGACAATTCAATGGG + Intronic
1127283747 15:57514866-57514888 GGGTGCCAAGACAATTCAATGGG - Intronic
1128190190 15:65685794-65685816 AGATGCCAAGGCAATTCAATGGG - Intronic
1128437394 15:67667308-67667330 TTCAGCTAAGGCAATTAAATAGG + Intronic
1130699670 15:86165766-86165788 CTGTTCCAAGGTATTTGAATTGG - Intronic
1130977211 15:88786008-88786030 TGATGCCAAGGCAATTCAATGGG + Intergenic
1131904297 15:97125635-97125657 CCATGTCAAGGCAATTCAATGGG + Intergenic
1134654223 16:15935297-15935319 GTGTGCTAAGACAATTCAATGGG + Intergenic
1135198564 16:20416452-20416474 GGGTACCAAGACAATTAAATGGG + Intronic
1135542368 16:23341191-23341213 AGGTGCCAAGACAATTAAATGGG + Intronic
1137287012 16:47024762-47024784 CTGTGCCCAGCCAATTACACAGG + Intergenic
1138005803 16:53336352-53336374 GAGTGCCAAGACAATTCAATGGG + Intergenic
1141122840 16:81374847-81374869 AGGTGCCAAGGCAATTTAGTGGG + Intronic
1143488160 17:7266806-7266828 CTGTACAAAGGCAATTCAGTGGG - Intergenic
1143690161 17:8555507-8555529 ATGTGTCAAGGTAATTTAATAGG + Intronic
1144342636 17:14322812-14322834 CTGTGCCAAGGCTCTTAATCTGG + Intronic
1147058200 17:37850814-37850836 ATGTGCCAAGACCATTTAATGGG - Intergenic
1147447036 17:40480769-40480791 CTGAGCCAAGGCAAAGAAACAGG + Intronic
1152480548 17:80548960-80548982 CTGTAGCAAGGCTACTAAATAGG - Intronic
1153503949 18:5776154-5776176 GGGTGCCAAGGCCATTCAATGGG - Intergenic
1153721875 18:7912293-7912315 GGGTACCAAGGCAATTTAATGGG - Intronic
1153834783 18:8954229-8954251 CTGTGCCCTGGCAATCAAAGCGG + Intergenic
1154419403 18:14212140-14212162 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1155406923 18:25499022-25499044 ACGTGCCAAGTCAATTCAATGGG + Intergenic
1156422665 18:36972145-36972167 AAGTGCTAAGGCAGTTAAATGGG + Intronic
1156705862 18:39881255-39881277 ATGAGCAAAGGCAATTCAATGGG + Intergenic
1156741199 18:40330847-40330869 GTGTGCCAAGGTGATTTAATGGG - Intergenic
1157623991 18:49033667-49033689 CTGTGCCAACGCCATTTATTGGG + Intergenic
1158215925 18:55100634-55100656 TTGTGCCAATGCAATTATCTTGG + Intergenic
1158270437 18:55707724-55707746 AGGTACCAAAGCAATTAAATGGG - Intergenic
1158594585 18:58804927-58804949 CTGTGGCAAGACACTGAAATAGG - Intergenic
1158951750 18:62501555-62501577 GGGTGCCAAGACAATAAAATGGG + Intergenic
1159230461 18:65601024-65601046 CTGTGGCAAGACAATTAATGAGG + Intergenic
1161743503 19:6040278-6040300 CTCAGACAAGGCATTTAAATGGG - Intronic
1162240552 19:9350080-9350102 GAGTGCCAAGACAATTCAATGGG - Intronic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1166272532 19:41724234-41724256 CGGTGCCAAGACCATTTAATGGG - Intronic
1166787787 19:45379706-45379728 CTGTGTGAAGGCACTTAATTGGG + Exonic
1202642016 1_KI270706v1_random:101681-101703 CTGTGCCAAGGAAATGCATTTGG + Intergenic
925025870 2:606839-606861 GTGTGCCCAGGGATTTAAATTGG + Intergenic
925249150 2:2415703-2415725 CAGTGCCAAAACAATGAAATAGG + Intergenic
926064549 2:9827321-9827343 ACGTGTCAAGACAATTAAATGGG + Intergenic
926492061 2:13536905-13536927 CTATGCCAATTGAATTAAATAGG + Intergenic
926903481 2:17783722-17783744 GAGTGCCAAGACAATTCAATGGG + Exonic
927953264 2:27188890-27188912 GGGTGCCAAGACAATTGAATGGG + Intergenic
928496680 2:31839979-31840001 CTGACCCAAGAAAATTAAATAGG - Intergenic
928497342 2:31847337-31847359 ATGTACCAAGGCAATTTATTGGG - Intergenic
928529689 2:32178349-32178371 GGGTACCAAGGCAATTCAATGGG - Intronic
929378930 2:41326026-41326048 AGGTGCCAAAGCAATTCAATGGG + Intergenic
929531829 2:42757438-42757460 CTGTGCCAAGGTCATTATAGGGG + Intergenic
929903028 2:46022329-46022351 CTGTGACAATGCAATTCATTGGG + Intronic
930519390 2:52445167-52445189 GTGTGTTAAGGCAATTCAATGGG - Intergenic
931522612 2:63116064-63116086 GGGTGCCAAGACCATTAAATGGG - Intergenic
931896676 2:66739397-66739419 GGGTGCCAAGACAATTCAATGGG - Intergenic
931951632 2:67370015-67370037 ATGTGCCAAGGCAGTTCAATGGG - Intergenic
932061763 2:68508337-68508359 AGGTGTCAAGACAATTAAATGGG + Intronic
932170110 2:69547026-69547048 GGGTGCCAAGACAATTCAATGGG + Intronic
933413414 2:81953087-81953109 AGGTGCCAAGACAATTCAATGGG + Intergenic
933511881 2:83250150-83250172 CTGTGCAAAAACAATTCAATGGG + Intergenic
933643562 2:84790139-84790161 AGGTGCCAAGGCAATTCAATGGG + Intronic
933763476 2:85691700-85691722 ACGTGCCAAAGCAATTCAATGGG + Intronic
934497849 2:94825161-94825183 CTGTGCCAAGGAAATGCATTTGG + Intergenic
934878237 2:97947907-97947929 GGGTGCCAAGGCAATTCAATTGG + Intronic
935241694 2:101184056-101184078 ATGTCCCAAGACAATTTAATGGG - Intronic
935791911 2:106600526-106600548 GGGTGCCAAGGCCATTCAATTGG - Intergenic
936240040 2:110779684-110779706 AGTTGCCAAGGCAATTCAATGGG + Intronic
936242896 2:110803395-110803417 CAGAGCCAAGACAATTCAATGGG + Intronic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
937538433 2:122919832-122919854 CTGAGAGAAGGCAAATAAATTGG + Intergenic
937749949 2:125463581-125463603 ATGTGCCAAGATAAATAAATGGG + Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938877083 2:135543235-135543257 CAGTGCCAAGACAATTCAATGGG - Intronic
939548199 2:143580248-143580270 TTGTGCCATTGCAAGTAAATAGG + Intronic
940186074 2:150986000-150986022 CTGTGCCAAGGCAGTTTCCTTGG - Intergenic
940533659 2:154910006-154910028 ATGTGCCAGGGCAATTCAATGGG - Intergenic
941308721 2:163903114-163903136 ATATGCCAAGGCATTTCAATGGG + Intergenic
941609970 2:167648773-167648795 ATGAGGCAAAGCAATTAAATGGG - Intergenic
943410945 2:187547068-187547090 CTCTGCCTAGGCAAATACATTGG + Intronic
943894785 2:193342481-193342503 CTGTGCAAATGCAATCAACTGGG - Intergenic
943925730 2:193776804-193776826 ATGTTCCATGTCAATTAAATTGG + Intergenic
944722540 2:202438727-202438749 GGGTGCCAAGACAATTCAATGGG - Intronic
945113330 2:206386330-206386352 ATTTGCCAAGGCAATTCAGTGGG + Intergenic
946977847 2:225173533-225173555 CTGTGACAAGACAAATAACTGGG - Intergenic
946978054 2:225175149-225175171 CTGTGACAAGACAAATAACTGGG + Intergenic
947055587 2:226097788-226097810 AATTGCCAAGGCAATTAAATGGG + Intergenic
947113764 2:226747623-226747645 CAGTCCCAAGGGAAATAAATGGG + Intronic
1168875088 20:1165923-1165945 TTGTGCCAAGCCTATGAAATTGG + Exonic
1169650373 20:7859993-7860015 TTGTACAAAGGCAATTCAATAGG + Intergenic
1169949272 20:11025195-11025217 GGGTGCCAAGACAATTCAATAGG - Intergenic
1170273655 20:14557099-14557121 GAGTGCCAAGACAATTCAATGGG + Intronic
1171397990 20:24851277-24851299 ATGTGCCAAGGTAATCCAATAGG + Intergenic
1172078755 20:32321111-32321133 GTATGCCAAGACAATGAAATGGG - Intronic
1172294829 20:33801481-33801503 GTGTGCTAAGACCATTAAATGGG - Intergenic
1172747104 20:37219818-37219840 ATGTGCCAAGGCAATTCGTTAGG - Intronic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1175739588 20:61411419-61411441 TTCTGCCAAGGCAATTATCTAGG - Intronic
1176609868 21:8870934-8870956 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1176853903 21:13947158-13947180 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177535213 21:22417768-22417790 CAGTGCCAAGCCTATTCAATGGG - Intergenic
1177594404 21:23216734-23216756 ATATGCCAAGCCAATTAAAAAGG - Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1177686594 21:24444953-24444975 TTTGGACAAGGCAATTAAATAGG + Intergenic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1179074421 21:38106542-38106564 CTGTACCAAGACAATTAAATGGG + Intronic
1179137008 21:38688297-38688319 CTGTACAAACGCAATTACATTGG - Intergenic
1179145672 21:38765457-38765479 CTGTGCCAAGGCACTTAAACAGG + Intergenic
1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG + Intronic
1180359928 22:11880183-11880205 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1181718434 22:24753399-24753421 GTGTGTCAAGGCAATTCAATAGG - Intronic
949714116 3:6908556-6908578 CTGTGAAAAGGCAAGCAAATAGG - Intronic
950262259 3:11551718-11551740 CTGTGCCCAGCCAATATAATGGG + Intronic
951093907 3:18606477-18606499 CTGTGTCAAGGGAATTATTTGGG - Intergenic
953008643 3:39002070-39002092 GTGTGCCAAGACTATTCAATGGG - Intergenic
953225836 3:41019214-41019236 ATGTGTCAAGGCAAGTCAATAGG + Intergenic
953484363 3:43281154-43281176 AATTGCCAAGGCAATTTAATTGG + Intergenic
954475841 3:50744841-50744863 GGGTGCCAAGACCATTAAATGGG - Intronic
956196945 3:66662324-66662346 TTGTGCCAAGGCAATGGAAGGGG - Intergenic
956462810 3:69488460-69488482 AGGTGCCAAGTCAATTCAATAGG + Intronic
956690211 3:71870703-71870725 GTGTGCAGAGGCAATTCAATAGG + Intergenic
959205026 3:103296865-103296887 CAGAGCCATGGCAATAAAATGGG + Intergenic
959518168 3:107293962-107293984 AGGTGCAAAGGCAATTCAATGGG - Intergenic
961253704 3:125527625-125527647 CAGTGGGAAGGCAATTAGATAGG + Intergenic
962529777 3:136268290-136268312 ATGTGTCAAGACAATTCAATGGG - Intronic
963389378 3:144638912-144638934 TGGTACCAAGGCAATTAAATGGG - Intergenic
964278632 3:155036990-155037012 AGGTGCCAAGGCAATTCAATGGG - Intronic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
967004087 3:185367192-185367214 GGGTGCCAAGACAATTTAATGGG - Intronic
967150806 3:186648254-186648276 GTATGCCAAGGCAACTACATGGG - Intronic
967618022 3:191597093-191597115 AAATGCCAAGGCAATTCAATAGG - Intergenic
967860582 3:194148434-194148456 CTGTACCAAGGCAATGAAATGGG - Intergenic
967906265 3:194503046-194503068 GGGTGCCAAGACAATTCAATGGG + Intergenic
968095460 3:195927079-195927101 ATGTGCCATGGCAATTCAATGGG - Intergenic
968201505 3:196759813-196759835 CTGTGCCCAGCCAGTTAAGTGGG + Intronic
968219034 3:196919849-196919871 TGGTGCCAAAGCAATGAAATTGG - Intronic
1202736549 3_GL000221v1_random:5719-5741 CTGTGCCAAGGAAATGCATTTGG - Intergenic
968715021 4:2150713-2150735 AGGCGCCAAGGTAATTAAATGGG + Intronic
969699149 4:8756698-8756720 CGGTGCAAAGGCAATTCAATAGG + Intergenic
970253968 4:14147639-14147661 CTTTCCCAAGGCCATTCAATTGG - Intergenic
970411386 4:15811539-15811561 GAGTGCCAAGGCCATTCAATGGG - Intronic
971023157 4:22559069-22559091 GGGTGCCAAGACAATTCAATGGG - Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971285284 4:25283254-25283276 AGGTGCCAAGGCAATTCAATGGG + Intergenic
971984233 4:33799607-33799629 CTGGGCCAAGGTGATTTAATTGG + Intergenic
972968071 4:44537256-44537278 CAGTGTAAAGGCAATTCAATAGG + Intergenic
973654276 4:53029707-53029729 ATGTGCAAAGGCAGTTCAATGGG + Intronic
973911740 4:55588747-55588769 GAGTGCCAAGACCATTAAATGGG - Intronic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
974394042 4:61312142-61312164 AAGTGCAAAGGCAATTTAATAGG + Intronic
974754285 4:66183516-66183538 CAGTGGCAAGGCAATTATCTGGG + Intergenic
977575577 4:98670650-98670672 CTGGGCCAAGCCAATTAAGAGGG + Intergenic
977767670 4:100819440-100819462 TTGTACCAAGGCAATAATATGGG - Intronic
978932953 4:114338587-114338609 AGGTGACAAGGCAATTGAATGGG - Intergenic
979557247 4:122062796-122062818 CCGTGCCCAGGCAATTTTATAGG + Intergenic
979694604 4:123598643-123598665 CTTTGCCAGGGCAAATGAATGGG - Intergenic
979845655 4:125507960-125507982 CTGTGCCTTGGAAATAAAATAGG - Intergenic
980343872 4:131586281-131586303 CTATTCCAAGGTAATTAATTTGG - Intergenic
980821222 4:138020181-138020203 GGGTGCCAAGACAATTCAATGGG + Intergenic
981146305 4:141329046-141329068 CTGTGTGAAGCCAATCAAATAGG - Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
982566005 4:156987609-156987631 AGATGCCAAGGCAATTCAATGGG - Intergenic
984699535 4:182809691-182809713 CAGTGCCAAGGCAAGTGAAAGGG + Intergenic
984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG + Intergenic
987179498 5:15352450-15352472 GTGTGCCAAGACCATTCAATGGG - Intergenic
987692252 5:21282316-21282338 CTTTTTCAAAGCAATTAAATTGG - Intergenic
987785480 5:22493374-22493396 CTCTACCAAGGCACTCAAATAGG + Intronic
987909167 5:24119505-24119527 GTGTGCCAAAGTAATTCAATAGG + Intronic
988592319 5:32559486-32559508 CTGTGGAAAGGTAAGTAAATGGG - Intronic
992015073 5:72567233-72567255 TTGTTCCAATGAAATTAAATTGG + Intergenic
992476425 5:77106421-77106443 TTGTGCCAAGCCATTTCAATGGG - Intergenic
992862353 5:80924197-80924219 AGGTGCAAAGGCAATTTAATAGG + Intergenic
993814900 5:92531116-92531138 CTGCACCAAGGCAATGAAACTGG + Intergenic
994406703 5:99353516-99353538 GATTGCCAAGTCAATTAAATAGG - Intergenic
994654627 5:102575684-102575706 GGGTGCCAAGACAATTCAATGGG - Intergenic
995179246 5:109214831-109214853 CTGTGCTGAGGCAACTAAAGAGG + Intergenic
995284655 5:110373969-110373991 AGGTGCCAAGGAAATTCAATGGG - Intronic
995636243 5:114194956-114194978 TGGTGCCAAGACAATTGAATGGG - Intergenic
995636297 5:114196057-114196079 GGGTGCCAAGACAATTGAATTGG - Intergenic
995788140 5:115853721-115853743 AAGTACCAAGGCAATTCAATAGG - Intronic
996566533 5:124884982-124885004 CTGTGCCCAGCCAAGAAAATGGG + Intergenic
997156751 5:131569440-131569462 AGGTACCAAGGCAATTCAATGGG + Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
998524885 5:142833554-142833576 CTGTTTGAAGGAAATTAAATGGG - Intronic
999922096 5:156332362-156332384 CTGTGCCCAAGAAATTACATAGG - Intronic
1000034723 5:157436785-157436807 CGGTGCCAAGACCATTCAATAGG + Intronic
1001165746 5:169365092-169365114 CTATACCAAGGGAATGAAATTGG - Intergenic
1001509228 5:172307073-172307095 AGGTGCCAAGGCAATTCAATGGG + Intergenic
1001877914 5:175216947-175216969 CTGTGCCAAGGCAGGGAGATGGG + Intergenic
1003055481 6:2814756-2814778 ATGTGCCAAGGCAATTCTATGGG - Intergenic
1003701946 6:8476264-8476286 AGGTTTCAAGGCAATTAAATGGG - Intergenic
1004069576 6:12286601-12286623 CTTTGCCAAGCCAATAAATTTGG - Intergenic
1004435374 6:15587612-15587634 AGGTGCCAAAGCAATTCAATGGG + Intronic
1004446346 6:15702638-15702660 AGATGCCAAGGCAATTCAATGGG - Intergenic
1005428739 6:25731540-25731562 CACAGCCGAGGCAATTAAATGGG - Intergenic
1007316046 6:40990073-40990095 CCATGTCAAAGCAATTAAATCGG + Intergenic
1007820370 6:44556389-44556411 CTGTGGCAAGGAAAAGAAATAGG + Intergenic
1008984871 6:57530329-57530351 TTGTGAGAAGGCAAATAAATGGG + Intronic
1009479438 6:64138584-64138606 CAGAGGCAAGGCAATTAAATAGG + Intronic
1010480526 6:76347463-76347485 CTGAGTCAAGGTAATTACATTGG + Intergenic
1012032208 6:94086008-94086030 CTTTGCCTATGAAATTAAATTGG + Intergenic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1013143969 6:107369043-107369065 AAGTGCCAAGACAATTCAATGGG + Intronic
1013355617 6:109343672-109343694 CAGTGCCAGGGCAAATAATTTGG - Intergenic
1014524359 6:122483681-122483703 TTGTGCGAAGGCAAATATATGGG + Intronic
1015140537 6:129926475-129926497 CTGTTCCAAAACAAATAAATAGG - Intergenic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1016583391 6:145655412-145655434 CTGTACCCAGGCACTGAAATAGG + Intronic
1017721897 6:157249356-157249378 AGGTGCAAAGGCAATTCAATGGG - Intergenic
1018663389 6:166110390-166110412 GAATGCCAAGGCAATAAAATGGG + Intergenic
1019087724 6:169497149-169497171 GGGTGCCAAGACCATTAAATGGG + Intronic
1019367109 7:639309-639331 GGGTGCCAAGGCAAGTCAATGGG + Intronic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1023459125 7:40375491-40375513 ATGTGCCAAGGCCATGAGATGGG - Intronic
1024435576 7:49350220-49350242 AGGTGCCAAGGCTATTCAATGGG - Intergenic
1027822687 7:83067771-83067793 CTGCTCTAAGGCAATTCAATAGG + Intronic
1027887395 7:83926808-83926830 CAGTGCCAAGAAAATTCAATGGG - Intergenic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1030775268 7:113527094-113527116 GTGTTCAATGGCAATTAAATCGG - Intergenic
1031091082 7:117355447-117355469 GGGTGCCAAGACAATTCAATGGG + Intergenic
1033473986 7:141673088-141673110 CTCTGCAAAGGCAATGAAGTGGG + Intronic
1034891572 7:154844107-154844129 CTGTGCCAAGGCAATACAGATGG + Intronic
1035549905 8:514331-514353 GAGTGCCAAGACAATTCAATGGG + Intronic
1037010213 8:13832596-13832618 GGATGCCAAGACAATTAAATGGG - Intergenic
1037327467 8:17707849-17707871 AGGTGCCAAGGCATTTAAATGGG + Intronic
1040556369 8:48481423-48481445 GGGTACCAAGGCAATTCAATGGG - Intergenic
1041189450 8:55338645-55338667 CTGTGCAAAGCCAATGACATTGG + Intronic
1041569019 8:59314781-59314803 CTGTTCAAAGGCACTTAAAATGG - Intergenic
1042805707 8:72768827-72768849 GGGTGCCAAGACAATTTAATGGG - Intronic
1043451691 8:80374287-80374309 ATGTGCCAAAGCTATTGAATGGG + Intergenic
1044231166 8:89779843-89779865 ATGTGCTAAGCCAATTCAATGGG - Intronic
1044734112 8:95260268-95260290 TTGTGTAAAGGAAATTAAATGGG - Intronic
1045108485 8:98917191-98917213 GTGTGTCAAGGCAATTAAACAGG - Intronic
1045798979 8:106079666-106079688 CTGGACCAAAGCACTTAAATAGG + Intergenic
1047204979 8:122795825-122795847 CTGTGACAGGGCAAGTATATGGG - Intronic
1047376044 8:124297475-124297497 AGGTGCCAGGGCAATTCAATGGG - Intergenic
1047676008 8:127202975-127202997 AGGTGCCAAGGCAATTGAGTAGG + Intergenic
1049049015 8:140177405-140177427 ATGTGCCAAGGTAATTCAAAGGG - Intronic
1049703897 8:144029241-144029263 GTGTGCAAAGACAATTCAATGGG - Intronic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1051004960 9:12332724-12332746 TGGTGCCAAAGCAATTCAATAGG + Intergenic
1051711718 9:19937150-19937172 CTGTGCCAGAGCAATTATAGAGG + Intergenic
1051947296 9:22584825-22584847 ATGGGCAAAAGCAATTAAATGGG - Intergenic
1052004788 9:23333659-23333681 GGGTGCCAAGACAATTCAATAGG + Intergenic
1052307554 9:27028062-27028084 GGGTGCTAAGGTAATTAAATGGG - Intronic
1053398104 9:37793456-37793478 AGGTGCCAAGACAATTCAATGGG + Intronic
1053659302 9:40255329-40255351 CTGTGCCAAGGAAATGCATTTGG - Intronic
1053812686 9:41870284-41870306 CTTAGCCAAAGCAATTAAATAGG + Intergenic
1053909673 9:42884693-42884715 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1054360338 9:64108092-64108114 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1054371429 9:64401631-64401653 CTGTGCCAAGGAAATGCATTTGG - Intronic
1054525296 9:66120887-66120909 CTGTGCCAAGGAAATGCATTTGG + Intronic
1054617909 9:67317155-67317177 CTTAGCCAAAGCAATTAAATAGG - Intergenic
1054679050 9:67891346-67891368 CTGTGCCAAGGAAATGCATTTGG - Intronic
1055042274 9:71887387-71887409 CTGTGCCAAGCAAACTAATTTGG + Intronic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1056913784 9:90727892-90727914 CTGTACCCAGACAACTAAATGGG + Intergenic
1057121119 9:92574939-92574961 ATGTGCCAAGACCATTCAATGGG + Intronic
1057703439 9:97380632-97380654 AGGTGCCAAGACAATTTAATGGG - Intergenic
1057753857 9:97814227-97814249 GGGTGCCAAGGCCATTCAATGGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1058083326 9:100722241-100722263 TTATGCAAAGGCAATTAGATAGG - Intergenic
1058304211 9:103416754-103416776 GAGTGCCAAGACAATTCAATGGG - Intergenic
1058361890 9:104157396-104157418 CTGCTCCAGGACAATTAAATAGG - Intergenic
1058362245 9:104162603-104162625 CTGCTCAAAGACAATTAAATAGG - Intergenic
1058643120 9:107106175-107106197 CTGTCCCAGGACAATTAACTTGG - Intergenic
1059834671 9:118137936-118137958 CTGTTTCAAAACAATTAAATTGG + Intergenic
1060003480 9:119979372-119979394 CTTTGCAAAGGCCATTAAAAAGG + Intergenic
1062033253 9:134371579-134371601 CAGTGCCATGGCCATGAAATGGG - Intronic
1203694268 Un_GL000214v1:81267-81289 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1203705281 Un_KI270742v1:36158-36180 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1203558723 Un_KI270744v1:29647-29669 CTGTGCCAAGGAAATGCATTTGG + Intergenic
1203642005 Un_KI270751v1:22796-22818 CTGTGCCAAGGAAATGCATTTGG - Intergenic
1187119422 X:16389582-16389604 GTGTGCCAAGACAATTAAATGGG + Intergenic
1187228813 X:17401114-17401136 GGGTGCCAAGACAATTCAATGGG + Intronic
1188517411 X:31002498-31002520 GAGTGCCAAGGCTCTTAAATAGG - Intergenic
1189759348 X:44305385-44305407 CTGTGCCATGGAAGTTATATTGG - Intronic
1189862264 X:45285634-45285656 GGGTGCCAAGACAATTCAATTGG - Intergenic
1190854735 X:54282697-54282719 GGGTGCCAAGGCTATTCAATGGG + Intronic
1190934796 X:54988713-54988735 GGGTGCCAAGACAATTAAGTAGG + Intronic
1191129954 X:56997042-56997064 GTATGCCAAGACAATTAAAAAGG - Intergenic
1191664492 X:63685692-63685714 AGGTGCCCAGGCAATTCAATAGG + Intronic
1192345971 X:70306163-70306185 GTATGCCAAGACAATTCAATGGG - Intronic
1193406939 X:81112112-81112134 AGGTGCCAAGGCCATTGAATGGG + Intergenic
1194375722 X:93131310-93131332 GGGTGCCAAGACAATTAAATGGG - Intergenic
1196067436 X:111480125-111480147 GAGTGCCAAGACAATTCAATGGG - Intergenic
1196702990 X:118692009-118692031 GGGTGCCAAGGCAATTGGATGGG - Intergenic
1197261365 X:124322207-124322229 TTGTTCCAAGGCAATTCAATAGG - Intronic
1197740642 X:129890654-129890676 AGATGCCAAGGCAATTCAATGGG + Intergenic
1198881035 X:141281379-141281401 AGGTACCAAGGTAATTAAATGGG - Intergenic
1199074552 X:143513249-143513271 CTGTGCCAGGGCCATTAAAAGGG - Intronic
1199093557 X:143716521-143716543 CAGTGCCAGGGCCATTAAAAGGG - Intronic
1199508100 X:148589057-148589079 CAGTGACAAGACAATCAAATTGG + Intronic
1199569082 X:149249494-149249516 ATGTGTCAAGGGAATTAAAATGG - Intergenic
1199722879 X:150555280-150555302 AGGTGCCAAGACAATTCAATGGG + Intergenic
1199923548 X:152436607-152436629 GGGTGCCAAGGTAATTCAATGGG + Intronic
1201234719 Y:11898102-11898124 CTAAGCCAAAGCAATTAACTGGG - Intergenic