ID: 924221607

View in Genome Browser
Species Human (GRCh38)
Location 1:241881469-241881491
Sequence AATGCTACTCCACTTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924221607 Original CRISPR AATGCTACTCCACTTGAAAG TGG Intronic
901464726 1:9413763-9413785 ACTGCCAAACCACTTGAAAGAGG + Intergenic
901946982 1:12712101-12712123 AATTCTCTTCCATTTGAAAGAGG - Intergenic
903083576 1:20834005-20834027 AATGCTACCACAATTGAAAGTGG + Intronic
907242407 1:53088077-53088099 CATCCTGCTCCACTTGAACGGGG + Exonic
907294621 1:53442336-53442358 AATACTGGTCCACTTGAAAAAGG + Intergenic
909981680 1:82109741-82109763 AATGAAACTGCTCTTGAAAGAGG + Intergenic
910250782 1:85196707-85196729 ATTGCTACTCACCTTGAAAAGGG + Intronic
911797158 1:102089808-102089830 AATGCCACTCCTTTTGAAAGGGG + Intergenic
911835276 1:102610998-102611020 AATGTTACACCTCTTAAAAGTGG - Intergenic
913446320 1:118954442-118954464 AATGCTTGTCAACTTGAGAGTGG + Intronic
916703597 1:167323466-167323488 AAAGCTACTCCACCAGAAAGCGG - Intronic
917551549 1:176036875-176036897 AATGCTCCTCCACTTACAATGGG - Intronic
918440824 1:184565614-184565636 AATGCCAATCCACTTTACAGGGG - Intronic
919543700 1:198884463-198884485 CATGCTACTCCACTTAATAATGG - Intergenic
921958328 1:221007359-221007381 AATTCTCCTCCCCTTGAATGGGG - Intergenic
922280180 1:224115468-224115490 AATTATAATCCACTTGAAAGTGG - Intronic
924221607 1:241881469-241881491 AATGCTACTCCACTTGAAAGTGG + Intronic
1063228325 10:4038133-4038155 AATCCGACTTCACATGAAAGTGG + Intergenic
1068361662 10:55981398-55981420 AATGCTGATCCACTTGAATAAGG - Intergenic
1071428750 10:85586156-85586178 AATCCAGGTCCACTTGAAAGTGG - Intergenic
1072493988 10:95936312-95936334 AATGCTACTTCTTTTGTAAGAGG + Intronic
1074354092 10:112766580-112766602 AATGCTAGTATACTTCAAAGAGG + Intronic
1074470868 10:113725551-113725573 AATGCCAATACACTTGAAAATGG + Intronic
1075043040 10:119123764-119123786 AATTTTATTCCACTTTAAAGAGG + Intronic
1077911679 11:6577369-6577391 AATGCTGCTCCTCTCTAAAGTGG - Intronic
1079538332 11:21541691-21541713 AATGCTGCTCAGCTAGAAAGAGG - Intronic
1085587846 11:77728363-77728385 AAGATTACTCTACTTGAAAGTGG + Intronic
1086512689 11:87576435-87576457 AATGCTACTTTATTTAAAAGAGG - Intergenic
1087447374 11:98271626-98271648 GATGCTACTCCAATAGAAATAGG - Intergenic
1088527142 11:110769177-110769199 AATCCTCCTCCCCTTGAATGTGG - Intergenic
1089189843 11:116645701-116645723 AATTCCCCTCCACTTGAATGTGG + Intergenic
1093496289 12:19762158-19762180 AATGCTAATCGTCTTGATAGAGG - Intergenic
1094256749 12:28438891-28438913 AAAGCTATTTCACTTGAAAATGG + Intronic
1095415494 12:41972360-41972382 AAATCTACTGCACTTGAAAATGG + Intergenic
1101704471 12:107209164-107209186 GATGCTACTTCAATTGGAAGAGG + Intergenic
1102560234 12:113756846-113756868 AAGGCCACACCACTAGAAAGTGG + Intergenic
1103255677 12:119539671-119539693 ACTGCCACTCCCCTGGAAAGGGG - Intronic
1106302768 13:28484609-28484631 ACTGCTACTCCAGCTTAAAGTGG - Intronic
1108859547 13:54838316-54838338 AATGCTACTACACAATAAAGAGG - Intergenic
1110005429 13:70260571-70260593 AAAACTACACCACTAGAAAGTGG + Intergenic
1110389467 13:74957367-74957389 AATTCAACTCCCCTTGAATGTGG + Intergenic
1116800387 14:49437614-49437636 AATTCTCCTCCACTTGAGTGTGG + Intergenic
1120767817 14:88346775-88346797 AATGCTCCTCAACTTGCAATGGG - Intergenic
1124934659 15:34158863-34158885 AGTGCTGCCCCATTTGAAAGGGG + Intronic
1129492793 15:75945766-75945788 AATGCTACTGAACTTAAAAATGG - Intronic
1130111655 15:80970366-80970388 AATTCTACTTCACTTAATAGGGG + Intronic
1130982668 15:88823498-88823520 AGTGCTTCTCCACTTTAAACTGG + Intronic
1131587532 15:93712333-93712355 AATGCTACTTTACATGAAAAAGG - Intergenic
1134301663 16:12997073-12997095 AATGCTCTTCCTCTTGATAGAGG - Intronic
1135795277 16:25435367-25435389 AATGCTACACAGCTAGAAAGTGG - Intergenic
1135904704 16:26500942-26500964 AATGATACTCTACTGGAAAAGGG + Intergenic
1138160322 16:54747104-54747126 AATGCTACTCCATTTTATATCGG - Intergenic
1141213164 16:81999772-81999794 AATGCTACACCCCTGGACAGAGG - Exonic
1144581768 17:16463292-16463314 CGTGCCACTCCACGTGAAAGGGG + Intronic
1147547029 17:41409648-41409670 AATGCTAAACCACTGGAGAGCGG + Intergenic
1150088848 17:62301692-62301714 ATTATTACTCCACTTAAAAGTGG - Intergenic
1151095118 17:71488640-71488662 GATGATAATCCACTTGAAACTGG - Intergenic
1153378358 18:4407458-4407480 ACTGCTACTCTACTTGCAAGTGG - Intronic
1153513773 18:5885453-5885475 ATTGTTATTCCACTTGAAATGGG - Exonic
1156061101 18:33077267-33077289 TAGGCTACTCTACTTGTAAGTGG - Intronic
1159319428 18:66827911-66827933 AATTCTACTCCCCTTGAAAATGG - Intergenic
1166594867 19:44036654-44036676 ATTGGTATTCCACTTGGAAGTGG + Intergenic
1166630917 19:44406950-44406972 AATGCTATTCCACAATAAAGAGG + Intergenic
925763674 2:7210506-7210528 AATGCTACTAAATTTGAAGGAGG + Intergenic
928579827 2:32696210-32696232 AATGCTATTCCTTTTTAAAGCGG + Intronic
931310417 2:61074287-61074309 AATGCCACTGAACTTAAAAGTGG + Intronic
933388487 2:81641454-81641476 AATCCTACTCCAAATGAAGGAGG + Intergenic
933833213 2:86226837-86226859 AATTCTCCTCCCCTTGAATGTGG + Intronic
938869891 2:135464202-135464224 AATGCTTTTCCCCTTCAAAGGGG + Intronic
940019887 2:149145691-149145713 AATACTACTTCACTTGAAGTTGG + Intronic
942407860 2:175674955-175674977 AATGGGACTCCACTGGAAATAGG - Intergenic
943448043 2:188014453-188014475 AATCCAACTCCATTTTAAAGTGG - Intergenic
944360557 2:198850586-198850608 ATTTCTACTTCAGTTGAAAGAGG - Intergenic
947323043 2:228944054-228944076 AAATCTACTTCAGTTGAAAGTGG + Intronic
1170130810 20:13017794-13017816 AATTCTAATCCACTTGAACCTGG + Intronic
1171481009 20:25455690-25455712 AATGCTCCTCCAAGAGAAAGTGG - Exonic
1174535644 20:51249186-51249208 AATGCCACTCAACATGAATGAGG - Intergenic
1175711973 20:61228620-61228642 AGAGCTACTTCACTTGAACGTGG + Intergenic
1177543041 21:22520465-22520487 ATAGCTACTCAACTAGAAAGAGG - Intergenic
1179248760 21:39655836-39655858 GATGCTTCTCCACTGGAAACTGG - Intronic
1179329647 21:40386751-40386773 ATTACTTCTCCACTTAAAAGTGG + Intronic
1179619934 21:42607360-42607382 CATGCTGCTCCACGTGGAAGTGG + Intergenic
1184228094 22:43142196-43142218 AATGTCACTTCACTTGAAGGTGG - Intronic
1184302540 22:43570705-43570727 AGTGCTTCTCATCTTGAAAGGGG + Intronic
1184842058 22:47057893-47057915 AATGCAACTACACTTGTAAAGGG + Intronic
950836477 3:15924514-15924536 AAGGCTACTTCACCAGAAAGTGG - Intergenic
950846737 3:16022524-16022546 AATGCTCTTCCCTTTGAAAGAGG - Intergenic
951282233 3:20765972-20765994 ACTACTACTCCACTTCCAAGGGG + Intergenic
951376023 3:21918340-21918362 ATTAATACTCCACTTTAAAGTGG + Intronic
956513709 3:70022833-70022855 AGAGCTATTCCACTTGAAAATGG - Intergenic
957556883 3:81773694-81773716 AATTCTCCTCCACTTGACTGTGG + Intergenic
959234527 3:103702339-103702361 AATGCTACCCTACTTTGAAGGGG + Intergenic
959751474 3:109841671-109841693 AACCCTGCTCAACTTGAAAGGGG + Intergenic
961369653 3:126421729-126421751 GATGCTTCTCCAGTTGGAAGAGG + Intronic
965773025 3:172200717-172200739 GATGCTCCTCCACTTAAGAGGGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966811577 3:183850484-183850506 AATGTTACTTTACTTGAAATAGG - Intronic
967356529 3:188578189-188578211 GTGGCCACTCCACTTGAAAGGGG - Intronic
969140970 4:5071242-5071264 CATGTTACTCCACAAGAAAGAGG + Intronic
971929100 4:33055399-33055421 ATTCCTACTCCAGTTGATAGGGG - Intergenic
973741622 4:53924553-53924575 GATTCTTTTCCACTTGAAAGGGG + Intronic
974335212 4:60534725-60534747 AATGCTACTACACTCTAAACTGG + Intergenic
974828462 4:67159719-67159741 GATTTTAGTCCACTTGAAAGAGG - Intergenic
980452877 4:132998205-132998227 AATGCAACAGCATTTGAAAGTGG - Intergenic
980733733 4:136855507-136855529 AAGGCTGCTCCTCTTTAAAGAGG - Intergenic
980995313 4:139774507-139774529 AATGCTACTACTCTTAGAAGTGG - Intronic
981205197 4:142032681-142032703 AACGCCACTCCACTAGCAAGTGG - Intronic
983461321 4:168028461-168028483 AATGTTATTCCACTTGGAGGTGG + Intergenic
984015297 4:174418193-174418215 TTTGCTCGTCCACTTGAAAGAGG + Intergenic
990558194 5:56956912-56956934 AAAGCTACCTGACTTGAAAGAGG + Intronic
991392992 5:66168952-66168974 ATTGCTACTCCACTTTATAGAGG + Intronic
994000653 5:94774749-94774771 AATGCTATTCCAGTTAAATGTGG + Intronic
994178767 5:96741050-96741072 AATGTAACTCCTTTTGAAAGGGG + Intronic
994821160 5:104652733-104652755 TATGCTACTCCCACTGAAAGTGG + Intergenic
996664185 5:126038769-126038791 AATGCTGCACAACTTAAAAGAGG - Intergenic
997944854 5:138191088-138191110 AATGCTACTTCTCTTGAAGGAGG - Intronic
997965872 5:138355575-138355597 ATTACTATTCCACTAGAAAGTGG - Intronic
1001563425 5:172684583-172684605 AATTCGACTGCACATGAAAGAGG + Intronic
1003657787 6:8029735-8029757 AATGCCACTCATCTTGAATGGGG - Intronic
1004292503 6:14381140-14381162 AATGCTTCTCCACTTCAAATTGG + Intergenic
1004326071 6:14674978-14675000 AATGCTACACCACAGGTAAGGGG + Intergenic
1004454923 6:15783574-15783596 AAGGCTATACCACTAGAAAGTGG + Intergenic
1007441346 6:41863798-41863820 CATGCCACTGCACTTCAAAGTGG - Intronic
1007907771 6:45480196-45480218 AACGCTATTCCATTGGAAAGCGG + Intronic
1010739061 6:79478561-79478583 AATGCATCTCCACTAGAAAATGG - Intergenic
1012255739 6:97029185-97029207 AATTCTCCTCCTCTTGAATGTGG - Intronic
1012410892 6:98955787-98955809 AAAGCAACTCCACTTAAAAAAGG - Intergenic
1014891155 6:126848379-126848401 AAGGGTACTTCATTTGAAAGAGG - Intergenic
1018214712 6:161515735-161515757 AAAGCTAACCCACTGGAAAGTGG - Intronic
1023025560 7:36046621-36046643 AAGGCTACTCAACTAGAAAGTGG - Intergenic
1024853333 7:53746365-53746387 AATGCTATTCCATTTGAAATGGG - Intergenic
1028164177 7:87519139-87519161 ACTGCTCCTCCAAATGAAAGGGG + Intronic
1030614848 7:111728678-111728700 AGTGGTACTCCACTGGAGAGGGG + Exonic
1031183445 7:118445732-118445754 AATTCTACTCCCCTTGACAGTGG + Intergenic
1035857827 8:2995700-2995722 AATGCTACTCCACAGGAAAAAGG + Intronic
1039020735 8:33203068-33203090 AATGTTACTCAACTAGTAAGTGG - Intergenic
1040653951 8:49482567-49482589 ATTTCTACTCCACTTCAAACTGG + Intergenic
1042375799 8:68050780-68050802 ATTCTTACTCCTCTTGAAAGTGG - Intronic
1042431861 8:68715971-68715993 AATACTACTCAACTTTAAAAAGG + Intronic
1045795113 8:106033872-106033894 AATGTTTTTCCAATTGAAAGTGG + Intergenic
1046042420 8:108921989-108922011 AATGCTACTAGGCTTGCAAGGGG + Intergenic
1047506886 8:125487154-125487176 AATGTTACACAACTAGAAAGAGG - Intergenic
1048589165 8:135805020-135805042 AGTGCTAGTCCACTTTAAACTGG - Intergenic
1050838408 9:10113726-10113748 AATGCTTCGCCACTTTAATGTGG + Intronic
1051470127 9:17429812-17429834 AATTCTACTATACTTAAAAGGGG - Intronic
1051794593 9:20851379-20851401 ACTGCTCTTCCACTTAAAAGAGG - Intronic
1053337861 9:37293079-37293101 ATTCCAACTCCACTTGAAATGGG - Intronic
1055005676 9:71503459-71503481 AATGTTATTCCATTTGAAAATGG - Intergenic
1056467464 9:86871780-86871802 AATGCTACTATACGTGAATGGGG + Intergenic
1057332021 9:94124116-94124138 AATGTTATTCCACTTTAAAGGGG - Intergenic
1058397769 9:104574912-104574934 ATTGCTATTCCCCTTGAAACTGG + Intergenic
1059116043 9:111600442-111600464 AAAGCTACACCACTAGTAAGTGG - Intergenic
1059373563 9:113863396-113863418 AATTCTCCTCCACTTGAATTTGG - Intergenic
1060276008 9:122183137-122183159 GATGCTACTTCATTTGAAAAAGG + Intronic
1186180001 X:6964197-6964219 GATGCTATTTCAATTGAAAGAGG - Intergenic
1186612261 X:11149022-11149044 AAAGGTACCCCACTTCAAAGAGG + Intronic
1187039921 X:15582943-15582965 ACTGCTGCTCAACTTCAAAGTGG + Intronic
1187808858 X:23153316-23153338 AATTCTCCTCCTCTTGAATGTGG - Intergenic
1188759234 X:34005141-34005163 AATGCTACTCCTCAGTAAAGTGG + Intergenic
1189616526 X:42789653-42789675 ATTGCTACTCATCTAGAAAGAGG + Intergenic
1193429466 X:81383077-81383099 AATGCTACTCCACTAAAAAGTGG - Intergenic
1194201687 X:90959160-90959182 AATGCTACTCCACTTGTTCTGGG - Intergenic
1199073957 X:143509630-143509652 AATGATATTCCACTGGAAAAAGG + Intronic
1199092957 X:143712878-143712900 AATGATATTCCACTGGAAAAAGG + Intronic
1200547526 Y:4534615-4534637 AATGCTACTCCACTTGTTCTGGG - Intergenic